preparation of therapeutic exosomes using membrane proteins

专利摘要:
The present invention relates to methods of preparing a therapeutic exosome using a newly identified protein to be enriched on the surface of the exosomes. Specifically, the present invention provides methods of using proteins for affinity purification of exosomes. It also provides methods for locating a therapeutic peptide in exosomes and targeting exosomes to a specific organ, tissue or cell using proteins. The methods involve the generation of surface-modified exosomes that include one or more of the higher density exosomal proteins, or a variant or fragment of the exosomal protein.
公开号:BR112020003354A2
申请号:R112020003354-5
申请日:2018-08-24
公开日:2020-08-18
发明作者:Kevin P. Dooley；Rane A. Harrison；Russell E. McConnell；Ke Xu；Damian Houde；Nikki Ross；Sonya Haupt；John D. Kulman；Douglas E. Williams
申请人:Codiak Biosciences, Inc.；
IPC主号:

专利说明:

[001] [001] The present application contains a Sequence Listing, which was submitted electronically in ASCII format and is hereby incorporated as a reference in its entirety. Said ASCII copy, created on August 22, 2018, is named 40714PCT_CRF_sequencelisting. txt and is 175,092 bytes in size. BACKGROUND OF THE INVENTION
[002] [002] Exosomes are important mediators of intercellular communication. They are also important biomarkers in the diagnosis and prognosis of many diseases, such as cancer. As drug delivery vehicles, exosomes offer many advantages over traditional drug delivery methods as a new treatment modality in many therapeutic areas.
[003] [003] The use of exosomes for therapeutic purposes requires that the exosomes are free or mainly free of impurities, including, but not limited to, contaminating proteins, DNA, carbohydrates and lipids. Current purification methods do not offer sufficient selectivity to remove significant amounts of these impurities; therefore, additional processes are desired to improve purity.
[004] [004] In addition, as exosomes become more frequently used in the treatment of human diseases, they may have difficulties in meeting clinical expectations due to the heterogeneity in their physical-chemical parameters that confer molecular targeting, immune avoidance and controlled release of medicines. This is mainly due to the heterogeneity and complexity of the exosome properties (for example, composition, size, shape, rigidity, surface charge, hydrophilicity, stability and type and density of binders), payload properties (for example, type of drug, solubility, load, potency, dosage, immune response and release kinetics) and in vivo physiological barriers to exosome trafficking (for example, immune surveillance, particle leakage, tissue targeting, tissue penetration and cell uptake). Although considerable effort has been made, effective methods for obtaining discrete subpopulations of therapeutic exosomes with desired properties, for example, exosomes containing therapeutic loads and having appropriate targeting portions, are not yet readily available.
[005] [005] Appropriate methods to generate, isolate and purify discrete sub-populations of exosomes are needed to better allow therapeutic use and other requests for exosome-based technologies. SUMMARY
[006] [006] One aspect of the present invention relates to new methods of preparing exosomes for therapeutic use. Specifically, the methods use newly identified surface markers to be enriched on the surface of exosomes. In particular, a group of proteins (for example, prostaglandin F2 receptor negative regulator (PTGFRN); basigine (BSG); member of the immunoglobulin 2 superfamily (IGSF2); member of the immunoglobulin 3 superfamily (IGSF3); member of the superfamily immunoglobulin 8 (IGSF8); beta-1 integrin (ITGB1); alpha-4 integrin (ITGA4); cell surface antigen heavy chain 4F2 (SLC3A2); and an ATP carrier protein class (ATP1A1, ATP1A2, ATP1A3, ATP1A4, ATP1B3, ATP2B1, ATP2B2, ATP2B3, ATP2B4)) have been identified as highly enriched on the surface of exosomes.
[007] [007] The newly identified proteins can be used in various embodiments of the present invention. One aspect of the present invention relates to the generation of a fusion protein by conjugating the newly identified exosomal protein and a therapeutic protein and producing a modified exosome containing the surface fusion protein. A full-length or biologically active native fragment of the therapeutic protein can be transported to the surface of exosomes by conjugation with proteins enriched with exosomes. The method using the newly identified exosomal proteins, as provided in this document, is better at producing surface-modified exosomes than methods using some other protein of exosomal structure known in the art (eg Lamp2B, PDGFR, lactaderin CD9 , CD63 and / or CD81 or fragments thereof). Without wishing to be bound by a theory, the newly identified proteins are believed to be better because several of the proteins of the exosome structure known in the art - that is, tetraspanin proteins, such as CD9, CD63 and CD81, have both C- and N-terminals in the lumen of the exosome.
[008] [008] Another aspect of the present invention relates to the purification of an exosome by affinity purification from a heterogeneous solution, as a cell culture medium or plasma, using the exosome proteins that are common to all exosomes, or common to all exosomes derived from a single cell type. Some modalities refer to the isolation of a subpopulation of exosomes from the total of exosomes using specific surface markers for a subpopulation of exosomes.
[009] [009] Another aspect of the present invention relates to methods of removing exosomes from a sample when the exosomes are a contaminating product. For example, natural or modified viruses can be purified from contaminating exosomes. The exosome proteins described in this document can be used to selectively remove exosomes from biological processes where other particles of similar size, shape and / or charge are the desirable product.
[0010] [0010] Another aspect of the present invention relates to the generation or use of a modified surface exosome for more efficient affinity purification, or to present a targeting fraction or a therapeutically relevant protein on the surface. For example, exosomal surfaces can be modified to contain the full-length native exosomal protein and / or a fragment or a modified protein of the native exosomal protein on the surface at a higher density.
[0011] [0011] The present invention also relates to a producer cell or a method of generating the producer cell for the production of such a modified surface exosome. An exogenous polynucleotide can be transiently or steadily introduced into a producer cell to cause the producer cell to generate a modified exosomal surface.
[0012] [0012] Specifically, one aspect of the present invention relates to a method of isolating an exosome, comprising the steps of: (1) providing a sample comprising the exosome; (2) contacting the sample with a binding agent having affinity with a target protein, wherein the target protein comprises PTGFRN, BSG, IGSF2, IGSF3, IGSF8, ITGB1, ITGA4, SLC3A2, ATP carrier or a fragment or a variant thereof; and (3) isolating the exosome based on a link between the target protein and the binding agent.
[0013] [0013] In some embodiments, the sample is obtained from a cell grown in vitro, optionally in which the cell is a cell
[0014] [0014] In some embodiments, the cell is genetically modified to express the target protein. In some embodiments, the cell comprises an expression plasmid that encodes the target protein. In some embodiments, the cell is genetically modified to comprise an exogenous sequence that expresses a marker with affinity for the binding agent, in which the exogenous sequence is inserted into a cell's genome. In some embodiments, the exogenous sequence is inserted into a genomic site located at the 3 'or 5' end of an endogenous sequence that encodes the PTGFRN, BSG, IGSF2, IGSF3, IGSF8, ITGB1, ITGA4, SLC3A2 or ATP transporter. In some embodiments, the endogenous sequence does not encode IGSF8. In some embodiments, the exogenous sequence is inserted into a genomic site located within an endogenous sequence that encodes the PTGFRN, BSG, IGSF3, IGSF8, ITGB1, ITGA4, SLC3A2 or ATP transporter.
[0015] [0015] In some embodiments, the target protein is a fusion protein comprising the marker and transporter PTGFRN, BSG, IGSF2, IGSF3, IGSF8, ITGB1, ITGA4, SLC3A2, ATP or a fragment or variant thereof. In some embodiments, the exosome comprises the target protein. In some embodiments, the target protein is not IGSF8 or a fragment or modification thereof. In some embodiments, the cell is genetically modified to have reduced expression of ADAM10.
[0016] [0016] In some embodiments, the exosome comprises the target protein. In some embodiments, the target protein is selected from the transporter of PTGFRN, BSG, IGSF2, IGSF3, ITGB1, ITGA4, SLC3A2 and ATP. In some embodiments, the target protein comprises a fragment or variant of the PTGFRN, BSG, IGSF2, IGSF3, IGSF8, ITGB1, ITGA4, SLC3A2 or ATP transporter. In some embodiments, the target protein comprises a polypeptide of SEQ ID NO: 33. In some embodiments, the target protein is a fusion protein comprising the transporter of PTGFRN, BSG, IGSF2, IGSF3, ITGB1, ITGA4, SLC3A2, ATP or a fragment or variant thereof and an affinity marker, where the marker of affinity has affinity with the binding agent. In some embodiments, the target protein does not comprise IGSF8 or a fragment or modification thereof.
[0017] [0017] In some embodiments, the linker comprises an immunoglobulin, a protein, a peptide or a small molecule. In some embodiments, the binding agent is attached to a solid support, optionally wherein the solid support comprises a porous agarose sphere, a microtiter plate, a magnetic sphere or a membrane.
[0018] [0018] In some embodiments, the solid support forms a chromatography column. In some embodiments, the step of contacting the sample with the binding agent is performed by applying the sample to the chromatography column.
[0019] [0019] In some modalities, the method still comprises the steps of: (1) contacting a subset of the sample with a different binding agent having an affinity for a different target protein; and (2) isolating the exosome based on a link between the different target protein and the different binding agent. In some embodiments, the different target protein comprises the transporter PTGFRN, BSG, IGSF2, IGSF3, IGSF8, ATP or a fragment or variant thereof. In some embodiments, the different target protein comprises a polypeptide of SEQ ID NO: 33.
[0020] [0020] Another aspect of the present invention relates to an exosome produced by the methods provided in this document.
[0021] [0021] In yet another aspect, the present invention relates to a pharmaceutical composition comprising the exosome of the present invention and an excipient. In some embodiments, the pharmaceutical composition comprises a lower concentration of macromolecules than the sample comprising the exosome source, wherein the macromolecules are nucleic acids, contaminating proteins, lipids, carbohydrates, metabolites or a combination thereof. In some embodiments, the pharmaceutical composition is substantially free of macromolecules.
[0022] [0022] Another aspect of the present invention relates to an exosome comprising a target protein in which at least part of the target protein is expressed from an exogenous sequence, and the target protein comprises the PTGFRN transporter, BSG , IGSF2, IGSF3, IGSF8, ITGB1, ITGA4, SLC3A2, ATP or a fragment or variant thereof. In some embodiments, the target protein does not comprise IGSF8 or a fragment or variant thereof. In some embodiments, the target protein comprises a polypeptide of SEQ ID NO: 33.
[0023] [0023] In some embodiments, the exosome is isolated based on a link between the target protein and a binding agent.
[0024] [0024] In some embodiments, the exosome is produced from a cell genetically modified to understand the exogenous sequence, optionally in which the cell is a HEK293 cell, a Chinese hamster ovary (CHO) cell or a mesenchymal stem cell (MSC). In some embodiments, the cell is genetically modified to have reduced expression of ADAM10.
[0025] [0025] In some embodiments, the cell comprises a plasmid comprising the exogenous sequence.
[0026] [0026] In some embodiments, the cell comprises the exogenous sequence inserted into a cell's genome. In some embodiments, the exogenous sequence is inserted into a genomic site located at the 3 'or 5' end of a genomic sequence that encodes the PTGFRN, BSG, IGSF2, IGSF3, IGSF8, ITGB1, ITGA4, SLC3A2 or ATP transporter. In some embodiments, the exogenous sequence is inserted into a genomic sequence that encodes the transporter PTGFRN, BSG, IGSF2, IGSF3, IGSF8, ITGB1, ITGA4, SLC3A2 or ATP. In some embodiments, the exogenous sequence does not encode IGSF8.
[0027] [0027] In some embodiments, the target protein is a fusion protein comprising the transporter of PTGFRN, BSG, IGSF2, IGSF3, IGSF8, ITGB1, ITGA4, SLC3A2, ATP or a fragment or variant thereof and an affinity marker , where the affinity tag has an affinity for the binding agent. In some embodiments, the target protein does not comprise IGSF8 or a fragment thereof.
[0028] [0028] In some embodiments, the target protein is a fusion protein comprising the marker and transporter PTGFRN, BSG, IGSF2, IGSF3, IGSF8, ITGB1, ITGA4, SLC3A2, ATP or a fragment or variant thereof, and a peptide therapeutic. In some embodiments, the target protein does not comprise IGSF8 or a fragment thereof.
[0029] [0029] The therapeutic peptide can be selected from a group consisting of a natural peptide, a recombinant peptide, a synthetic peptide or a linker to a therapeutic compound. The therapeutic compound can be selected from the group consisting of nucleotides, amino acids, lipids, carbohydrates and small molecules.
[0030] [0030] The therapeutic peptide can be an antibody or a fragment or a variant thereof. The therapeutic peptide can be an enzyme, a linker, a receptor or a fragment or a variant thereof. The therapeutic peptide can be an antimicrobial peptide or a fragment or variant thereof.
[0031] [0031] In some embodiments, the target protein is a fusion protein comprising the marker and transporter PTGFRN, BSG, IGSF2, IGSF3, IGSF8, ITGB1, ITGA4, SLC3A2, ATP or a fragment or variant thereof, and a portion targeting. The target fraction can be specific to an organ, tissue or cell. In some embodiments, the target protein does not comprise IGSF8 or a fragment thereof.
[0032] [0032] In some embodiments, the exosome further comprises a second different target protein, wherein the different target protein comprises PTGFRN, BSG, IGSF2, IGSF3, IGSF8, ITGB1, ITGA4, SLC3A2, ATP or a fragment or a transporter variant thereof. In some embodiments, the exosome is isolated based on a link between the different target protein and a different binding agent. In some embodiments, the target protein does not comprise IGSF8 or a fragment thereof.
[0033] [0033] In another aspect, the present invention relates to a pharmaceutical composition comprising the exosome of the present invention and an excipient.
[0034] [0034] In some embodiments, the pharmaceutical compositions are substantially free of macromolecules, in which the macromolecules are selected from nucleic acids, contaminating proteins, lipids, carbohydrates, metabolites and a combination thereof.
[0035] [0035] In one aspect, the present invention is directed to a cell for the production of the exosome presented in this document.
[0036] [0036] Specifically, some modalities refer to a cell for the production of exosomes, comprising an exogenous sequence inserted in a genomic sequence that encodes the transporter PTGFRN, BSG, IGSF2, IGSF3, IGSF8, ITGB1, ITGA4, SLC3A2 or ATP, in that the exogenous sequence and the genomic sequence encode a fusion protein. In some embodiments, the genomic sequence does not encode IGSF8.
[0037] [0037] The exogenous sequence can encode an affinity marker.
[0038] [0038] The exogenous sequence can encode a therapeutic peptide. The therapeutic peptide can be selected from a group consisting of a natural peptide, a recombinant peptide, a synthetic peptide or a linker to a therapeutic compound. The therapeutic compound can be selected from the group consisting of nucleotides, amino acids, lipids, carbohydrates and small molecules. The therapeutic peptide can be an antibody or a fragment or a variant thereof. The therapeutic peptide can be an enzyme, a linker, a receptor or a fragment or a variant thereof. The therapeutic peptide can be an antimicrobial peptide or a fragment or variant thereof.
[0039] [0039] The exogenous sequence can encode a targeting portion. The target fraction can be specific for an organ, tissue or cell.
[0040] [0040] In some embodiments, the cell line is genetically modified to have reduced ADAM10 expression.
[0041] [0041] In one aspect, the present invention provides an exosome produced from the cell line of the present invention. In some embodiments, the exosome includes the surface fusion protein at a higher density than a different fusion protein on the surface of a different exosome, where the different exosome is produced from a different cell line comprising the exogenous sequence inserted into a different genomic sequence encoding a conventional exosomal protein, where the exogenous sequence and the different genomic sequence encodes the different fusion protein. In some modalities, the conventional exosomal protein is selected from the group consisting of the anchoring proteins of CD9, CD63, CD81, PDGFR, GPI, LAMP2, LAMP2B and a fragment thereof.
[0042] [0042] In another aspect, the present invention relates to a method for isolating a non-exosomal material, comprising the steps of: providing a sample comprising an exosome and the non-exosomal material; contacting the sample with a binding agent with affinity for a target protein, wherein the target protein comprises the PTGFRN, BSG, IGSF2, IGSF3, IGSF8, ITGB1, ITGA4, SLC3A2, ATP transporter or a fragment or a variant thereof, inducing the exosome to bind to the binding agent; and isolating the non-exosomal material.
[0043] [0043] In some embodiments, the non-exosomal material is a virus or a protein. In some modalities, the non-exosomal material is lentivirus, retrovirus, adeno-associated virus or other enveloped or non-enveloped viruses. In some embodiments, the non-exosomal material is a recombinant protein. In some embodiments, the isolated non-exosomal material is substantially free of exosomes.
[0044] [0044] In some embodiments, the target protein further comprises an affinity marker, wherein the affinity marker has an affinity for the binding agent. In some embodiments, the target protein comprises a polypeptide of SEQ ID NO: 33. In some embodiments, the linker comprises an immunoglobulin, a protein, a peptide or a small molecule. In some embodiments, the binding agent is attached to a solid support, optionally wherein the solid support comprises a porous agarose sphere, a microtiter plate, a magnetic sphere or a membrane. In some embodiments, the solid support forms a chromatography column. In some embodiments, the step of contacting the sample with the binding agent is performed by applying the sample to the chromatography column.
[0045] [0045] In some embodiments, the purification methods described in this document are used for the purification of nanovesicles. In some embodiments, the compositions and methods described in this document are targeted at nanovesicles. BRIEF DESCRIPTION OF THE DRAWINGS
[0046] [0046] The figures represent various embodiments of the present invention for illustrative purposes only. A person skilled in the art will readily recognize from the above discussion that alternative modalities of the structures and methods illustrated in this document can be employed without departing from the principles of the invention described in this document.
[0047] [0047] Figure 1 provides an image of the Optiprep ™ density gradient containing sample after ultracentrifugation. Marked with parentheses are the upper fraction containing exosomes ("Superior"), the average fraction containing cellular residues ("Medium") and the lower fraction containing high density aggregates and cellular residues ("Lower").
[0048] [0048] Figure 2 is a dot plot showing the proteins identified in the upper fraction (Y axis) and the proteins identified in the lower fraction (X axis) of the Optiprep ™ ultracentrifugation. The proteins plotted above the dotted line represent proteins enriched with exosomes, while those below the dotted line represent non-specific proteins for exosomes.
[0049] [0049] Figure 3 provides a coverage map of PTGFRN triptych peptide (SEQ ID NO: 1).
[0050] [0050] Figure 4 provides an IGSF8 triptych peptide coverage map (SEQ ID NO: 14).
[0051] [0051] Figure 5 provides a Basigin triptych peptide (BSG) coverage map (SEQ ID NO: 9).
[0052] [0052] Figure 6A shows an image of protein transfer from the total cell lysate (left) and from the populations of purified exosomes (right) collected from HEK293 cells. Figure 6B shows a result of the western blotting test of the gel provided in Figure 6A with an antibody against PTGFRN. The band detected in the right column corresponds to a ~ 110kDa band in Figure 6A.
[0053] [0053] Figure 7A shows the transfer of proteins from twelve fractions collected from a purification using autoforming Optiprep ™ gradients. Figure 7B shows a result of the western transfer of the gel shown in Figure 7A with antibodies against ITGA4, ITGB1, PTGFRN, IGSF3, IGSF8, Basigin, Alix or Syntenin. Each of the new exosomal surface proteins (ITGA4, ITGB1, PTGFRN, IGSF8, Basigin) is detected in the same fractions as the known exosome marker proteins (Alix, Syntenin).
[0054] [0054] Figure 8 illustrates exosomal surface proteins (ITGA4, ITGB1, PTGFRN, IGSF8, BSG) that are used for various embodiments of the present invention, for example, to target a fusion protein on the surface of an exosome or as a target for affinity purification of an exosome.
[0055] [0055] Figure 9A illustrates the structure of PTGFRN with identification of boundaries of IgV domains (arrows) and GFP fused to the C terminal of PTGFRN. Figure 9B provides a gel image of western blotting exosomes isolated from a cell culture that overexpress various GFP-PTGFRN fusion proteins. GFP-PTGFRN fusion proteins were detected using an antibody against GFP.
[0056] [0056] Figure 10 provides a gel image running total proteins from purified exosomes isolated from cells that overexpress various GFP-PTGFRN fusion proteins.
[0057] [0057] Figure 11A illustrates the structure of PTGFRN with identification of boundaries of IgV domains (arrows) and FLAG fused to the N-terminal of PTGFRN. Figure 11B provides a gel image of western blotting exosomes isolated from a cell culture that overexpress various FLAG-PTGFRN fusion proteins. GFP-PTGFRN fusion proteins were detected using an antibody against FLAG marker.
[0058] [0058] Figure 12A provides a gel image executing total proteins from purified exosomes isolated from wild type cells (ADAM10 +) or ADAM10 knockout cells (ADAM10-), each cell expressing a full length GFP fusion protein containing PTGFRN ( PTGFRN-GFP) or a truncated PTGFRN (PTGFRN_IgV3-GFP). Figure 12B provides a western blotting gel image of the Figure 12A samples using an antibody against ADAM10. Figure 12C provides a western blotting gel image of the Figure 12A samples using an antibody against GFP.
[0059] [0059] Figure 13 illustrates the structure of a fusion protein containing PTGFRN without five of the six IgV domains (PTGFRN_IgV6), FLAG marker and a fusion partner protein.
[0060] [0060] Figure 14A provides sequences of PTGFRN_IgV6 (# 451) (SEQ ID NO: 42) and serial truncation mutants of PTGFRN_IgV6 without four (# 452) (SEQ ID NO: 43), eight (# 453) (SEQ ID NO: 44) or twelve (# 454) (SEQ ID NO: 45) additional amino acids. Figure 14B provides a gel image running total proteins from purified exosomes isolated from cells that overexpress a # 451, 452, 453 or 454 fusion protein. Figure 14C provides a western blotting gel image of the sample in Figure 14B using a antibody against FLAG.
[0061] [0061] Figure 15 provides GFP fluorescence signals detected from isolated cell exosomes that overexpress various GFP fusion proteins - GFP fusion proteins contain GFP fused to the luminal side of the frequently used pDisplay scaffold (PDGF receptor), PalmPalm (palmitoylation sequence), CD81 or full length PTGFRN (FL) or PTGFRN_454 (sIgV).
[0062] [0062] Figure 16A illustrates the structure of a fusion protein containing IGSF8 and GFP fused to the C-terminus of IGSF8. Figure 16B provides a gel image running total proteins from exosomes isolated from non-transfected (native) HEK293 cells or HEK cells stably transfected with a construct encoding an IGFS8-GFP fusion protein. Figure 16B also provides a western blotting gel image at the bottom of the sample with an antibody against GFP.
[0063] [0063] Figure 17 provides GFP fluorescence signals detected from exosomes isolated from cells that overexpress various GFP fusion proteins - the GFP fusion proteins contain GFP fused to the luminal side of the frequently used pDisplay scaffold (PDGF receptor), CD81 , Full-length IGSF8, or full-length PTGFRN (FL) or PTGFRN_454 (sIgV).
[0064] [0064] Figure 18 provides a structure of a fusion protein containing the extracellular domain (ECD) of PTGFRN, the endogenous signal peptide at the N-terminus (SP), a PAR1 cleavage site and the Fc domain at the C-terminus. Figure 18 discloses SEQ ID NO: 46.
[0065] [0065] Figure 19A provides a result of gel filtration chromatography of purified PTGFRN ECD in PBS pH 7.4 using a Superdex 200 column (Millpore Sigma) at 280 nm fluorescence
[0066] [0066] Figure 20A provides multi-angle size exclusion / light scattering chromatography results (SEC-MALS) of PTGFRN ECD, anti-VLA4 antibody and BSA. Figure 20B provides results by size exclusion chromatography (SEC) of PTGFRN ECD in the absence of guanidium chloride (GuHCl) or in the presence of 1M or 2M guanidinium chloride (GuHCl). Peaks representing a PTGFRN monomer or dimer are indicated.
[0067] [0067] Figure 21 provides the three main occurrences identified as binding partners to the PTGFRN ectodomain from a pH 7.4 binding test (higher) and the five main occurrences identified from the pH 5 binding test, 6 (bottom).
[0068] [0068] Figure 22 provides results of bio-layer interferometry (BLI) for the study of the interaction between PTGFRN and LGALS1 in the presence of increasing concentrations of LGALS1.
[0069] [0069] Figure 23 provides bio-layer interferometry (BLI) results for the study of the interaction between PTGFRN and LGALS1 in the presence of increasing lactose concentrations.
[0070] [0070] Figure 24 provides results of biological layer interferometry (BLI) to study the interaction between PTGFRN and anti-CD315 antibody in the presence of increasing concentrations of anti-CD315 antibody.
[0071] [0071] Figure 25 provides bio-layer interferometry (BLI) results for the study of the interaction between anti-CD315 antibody and native exosomes in the presence of increasing concentrations of native exosomes isolated from HEK293.
[0072] [0072] Figure 26 provides bio-layer interferometry (BLI) results for studying the interaction between anti-CD315 antibody and modified exosomes to overexpress PTGFRN (PTGFRN ++ exosomes) in the presence of increasing concentrations of the modified exosomes.
[0073] [0073] Figure 27 provides bio-layer interferometry (BLI) results to compare the interaction between anti-CD315 antibody and native exosomes, or between anti-CD315 antibody and modified exosomes that overexpress PTGFRN (PTGFRN ++).
[0074] [0074] Figure 28 provides biological layer interferometry (BLI) results to study the interaction between the anti-CD315 antibody and the full-length PTGFRN or between the anti-CD315 antibody and a series of truncated PTGFRN mutants.
[0075] [0075] Figure 29A provides a gel image running biotinylated proteins in vivo, including truncated recombinant PTGFRN mutants isolated from transfected HEK cells and purified exosomes from HEK293 cells. Figure 29B provides a western blotting gel image of the Figure 29A sample using combined polyclonal PTGFRN antibodies.
[0076] [0076] Figure 30 provides bio-layer interferometry (BLI) results for the study of the interaction between PTGFRN polyclonal antibodies and various PTGFRN truncation mutants.
[0077] [0077] Figure 31 provides the number of peptide spectrum matches (PSMs) of surface proteins (PTGFRN, IGSF8, IGSF3, BSG, SLC3A2, ITGB1, CD81 and CD9) for purified exosomes from several cell lines of different origins (HEK293SF , kidney; HT1080, connective tissue; K562, bone marrow; MDA-MB-231, breast; Raji, lymphoblasts; mesenchymal stem cells (MSC), bone marrow).
[0078] [0078] Figure 32A provides a gel image executing native exosomes and PTGFRN knockout (KO). Figure 32B provides a western blotting gel image of the sample in Figure 32A using combined polyclonal PTGFRN antibodies.
[0079] [0079] Figure 33 provides a scatter plot of peptide spectrum correspondences (PSMs) from purified native exosomes (y-axis) and PTGRN KO (x-axis).
[0080] [0080] Figure 34 provides BLI results for the study of the interaction between an anti-CD315 monoclonal antibody and the native exosomes PTGFRN ++ and PTGFRN KO.
[0081] [0081] Figure 35A provides an image of a polyacrylamide gel from an in vitro exosome purification of native exosomes and PTGFRN (KO) knockout using an immobilized anti-PTGFRN monoclonal antibody. Figure 35B provides a Western blotting gel image of the Figure 35A samples using an anti-PTGFRN antibody.
[0082] [0082] Figure 36A provides an image of a polyacrylamide gel running native exosomes or modified exosomes manipulated to express PTGFRN-BDDFIII. Figure 36 B provides a Western blotting gel image of the samples in Figure 36A using CD81 antibodies (upper) or FVIII antibodies (lower).
[0083] [0083] Figure 37A provides an image of a polyacrylamide gel running native or modified exosomes manipulated to express XTEN-PTGFRN-GFP. Figure 37B provides a Western blotting gel image of the samples in Figure 37A using ALIX antibodies (upper) or GFP antibodies (lower).
[0084] [0084] Figure 38 is a graph that provides percentages of positive particles for GFP (black bars, left y-axis) and average fluorescent intensity (gray bars, right y-axis) in four different groups of exosomes - modified exosomes manipulated to express ( i) CD9 -GFP, (ii) CD81-GFP, or (iii) PTGFRN-GFP, or
[0085] [0085] Figure 39 provides the fluorescence intensity (FU) of modified exosomes GFP that express a GFP fusion protein containing a native PTGFRN (PTGFRN-GFP), a truncated PTGFRN (454-PTGFRN-GFP) with its own peptide signal or a truncated PTGFRN (454-PTGFRN -GFP) with a DsbA11 synthetic signal peptide.
[0086] [0086] Figure 40A shows a structure of a fusion protein consisting of a single Fab chain that recognizes lectin CLEC9A, a PTGFRN, GFP and a full-length FLAG marker. Figure 40B provides a gel image of exosomes purified by Western blotting Optiprep ™ using anti-ALIX antibodies (upper) or GFP antibodies (lower).
[0087] [0087] Figure 41 provides BLI results for studying the interaction between CLEC9A-Fc and modified exosomes to express a fusion protein consisting of a single Fab chain recognizing CLEC9A lectin, a PTGFRN, GFP and a full-size FLAG marker ("αCLEC9A-PTGFRN").
[0088] [0088] Figure 42 provides gel photos of purified western blotting exosomes from HEK293SF ("HEK") cells or MSCs ("MSC") with antibodies against PTGFRN, ALIX, TSG101, CD63, CD9 or CD81.
[0089] [0089] Figure 43A provides an image of a polyacrylamide gel running purified exosomes from untransfered HEK cells, HEK cells transfected with a full-length PTGFRN-expressing plasmid fused to a FLAG marker ("the PTGFRN-FLAG plasmid") , CHO cells not transferred or CHO cells transfected with the plasmid PTGFRN-FLAG. Figure 43B provides a Western blotting gel image of the samples in Figure 43A using an antibody to PTGRN. Figure 43C provides a Western blotting gel image of the samples in Figure 43A using an antibody against a FLAG marker.
[0090] [0090] Figures 44A-B illustrate an experimental system for testing the loading of a loading protein into the lumen of the exosome using CD9 (Figure 44A) or PTGFRN (Figure 44B). Figure 44A illustrates a cell expressing CD9 fused to GFP, a FLAG and FKBP marker, which can interact with mCherry fused to a V5 and FKBP marker in the presence of Rapamycin. Figure 44B illustrates a cell expressing PTGFRN fused to GFP, a FLAG and FKBP marker, which can interact with mCherry fused to a V5 and FKBP marker in the presence of Rapamycin.
[0091] [0091] Figure 45A provides an image of a polyacrylamide gel running purified exosomes from the cell culture samples illustrated in Figure 44A (CD9) or Figure 44B (PTGFRN) (top). The figure also provides Western blotting results using an antibody against FLAG (αFlag) or V5 (αV5) (lower). Figure 45B provides band intensities for FLAG and V5 from Western blotting in Figure 45A, measured by densitometry and normalized for the amount of exosomes collected.
[0092] [0092] Unless otherwise defined, all technical and scientific terms used in this document have the meaning that is normally understood by a person versed in the technique to which this invention belongs. As used in this document, the following terms have the meaning assigned to them below.
[0093] [0093] As used in this document, the term "extracellular vesicle"; or "EV" refers to a cell-derived vesicle that comprises a membrane that surrounds an internal space. Extracellular vesicles comprise all vesicles attached to the membrane that have a smaller diameter than the cell from which they are derived. Generally, extracellular vesicles vary in diameter from 20 nm to 1000 nm and can comprise various macromolecular charges within the internal space, displayed on the external surface of the extracellular vesicle and / or covering the membrane. Said charge may comprise nucleic acids, proteins, carbohydrates, lipids, small molecules and / or combinations thereof. By way of example and without limitation, extracellular vesicles include apoptotic bodies, cell fragments, vesicles derived from cells by direct or indirect manipulation (for example, serial extrusion or treatment with alkaline solutions), vesiculated organelles and vesicles produced by living cells (for example, by direct budding of the plasma membrane or fusion of the late endosome with the plasma membrane). Extracellular vesicles can be derived from a living or dead organism, explanted tissues or organs and / or cultured cells.
[0094] [0094] As used in this document, the term "exosome" refers to a small cell-derived vesicle (between 20-300 nm in diameter, more preferably 40-200 nm in diameter) that comprises a membrane surrounding an internal space and which is generated from said cell by direct budding of the plasma membrane or by fusion of the late endosome with the plasma membrane. The exosome comprises lipid or fatty acid and polypeptide and optionally comprises a payload (eg, a therapeutic agent), a receptor (eg, a targeting moiety), a polynucleotide (eg, a nucleic acid, RNA or DNA), a sugar (for example, a simple sugar, polysaccharide or glycan) or other molecules. The exosome can be derived from a producer cell and isolated from the producer cell based on its size, density, biochemical parameters or a combination of them. An exosome is a kind of extracellular vesicle. Generally, the production of exosomes / biogenesis does not result in the destruction of the producing cell.
[0095] [0095] As used in this document, the term "nanovesicle" refers to a small cell-derived vesicle (between 20-250 nm in diameter, more preferably 30-150 nm in diameter) comprising a membrane that surrounds an internal space and which is generated from said cell by direct or indirect manipulation, so that said nanovesicle would not be produced by said producing cell without said manipulation. Appropriate manipulations of said producing cell include, but are not limited to, serial extrusion, treatment with alkaline solutions, sonication or combinations thereof. The production of nanovesicles can, in some cases, result in the destruction of the said producer cell. Preferably, nanovesicle populations are substantially free of vesicles that are derived from producer cells through direct budding of the plasma membrane or fusion of the late endosome with the plasma membrane. The nanovesicles comprise lipid or fatty acid and polypeptide and optionally comprise a payload (for example, a therapeutic agent), a receptor (for example, a targeting portion), a polynucleotide (for example, a nucleic acid, RNA or DNA), a sugar (for example, a simple sugar, polysaccharide or glycan) or other molecules. The nanovesicle, since it is derived from a producer cell according to said manipulation, can be isolated from the producer cell based on its size, density, biochemical parameters or a combination of them. A nanovesicle is a kind of extracellular vesicle.
[0096] [0096] As used in this document, the term "surface-modified" exosome "refers to an exosome with a modified membrane in its composition. For example, the membrane is modified in its composition from a protein, lipid, small molecule, carbohydrate, etc. The composition can be changed by a chemical, physical or biological method or because it was produced from a cell previously or simultaneously modified by a chemical, physical or biological method, specifically, the composition can be changed by genetic manipulation or being produced from a cell previously modified by genetic manipulation.
[0097] [0097] As used in this document, the term "a modification"; of a protein refers to a protein with at least 15% identification with the non-mutant amino acid sequence of the protein. A protein modification includes a fragment or variant of the protein. A modification of a protein may also include chemical or physical modifications to a fragment or variant of the protein.
[0098] [0098] As used in this document, the term "a fragment"; of a protein refers to a protein that is deleted at the N and / or C terminus compared to the naturally occurring protein. Preferably, a PTGFRN, BSG, IGSF2, IGSF3, IGSF8, ITGB1, ITGA4, SLC3A2 or ATP carrier fragment maintains the ability to be targeted specifically to exosomes. This fragment is also called a "functional fragment". If a fragment is a functional fragment in that sense, it can be evaluated by any method known in the art to determine the protein content of exosomes, including Western Blots, FACS analysis and fusions of the fragments with autofluorescent proteins such as, for example, GFP. In a specific embodiment, the carrier fragment PTGFRN, BSG, IGSF2, IGSF3, IGSF8, ITGB1, ITGA4, SLC3A2, ATP retains at least 50%, 60%, 70%, 80%, 90% or 100% of the carrier's capacity PTGFRN, BSG, IGSF2, IGSF3, IGSF8, ITGB1, ITGA4, SLC3A2 or naturally occurring ATP to be specifically targeted to exosomes.
[0099] [0099] As used in this document, the term "variant" of a protein refers to a protein that shares a certain amino acid sequence identity with another protein after alignment by a method known in the art. A variant of a protein can include a substitution, insertion, deletion, frameshift or rearrangement in another protein. In a specific embodiment, the variant is a variant with at least 70% identity for the carrier PTGFRN, BSG, IGSF2, IGSF3, IGSF8, ITGB1, ITGA4, SLC3A2, ATP or a fragment of the carrier PTGFRN, BSG, IGSF2, IGSF3, IGSF8, ITGB1, ITGA4, SLC3A2 or ATP. In some variant or variant embodiments of fragments of PTGFRN they share at least 70%, 80%, 85%, 90%, 95% or 99% of sequence identity with PTGFRN according to SEQ ID NO: 1 or with a functional fragment this. In some variant or variant embodiments of BSG fragments they share at least 70%, 80%, 85%, 90%, 95% or 99% of sequence identity with BSG according to SEQ ID NO: 9 or with a functional fragment this. In some variant or variant embodiments of IGSF2 fragments they share at least 70%, 80%, 85%, 90%, 95% or 99% of sequence identity with IGSF2 according to SEQ ID NO: 34 or with a functional fragment this. In some variant or variant embodiments of IGSF3 fragments they share at least 70%, 80%, 85%, 90%, 95% or 99% of sequence identity with IGSF3 according to SEQ ID NO: 20 or with a functional fragment this. In some variant or variant embodiments of IGSF8 fragments they share at least 70%, 80%, 85%, 90%, 95% or 99% of sequence identity with IGSF8 according to SEQ ID NO: 14 or with a functional fragment this. In some variant or variant embodiments of ITGB1 fragments they share at least 70%, 80%, 85%, 90%, 95% or 99% sequence identity with ITGB1 according to SEQ ID NO: 21 or with a functional fragment this.
[00100] [00100] Sequence alignment methods for comparison are well known in the art. Various alignment programs and algorithms are described in: Smith and Waterman, Adv. Appl. Math. 2: 482 (1981); Needleman and Wunsch, J. Mol. Bio. 48: 443 (1970); Pearson and Lipman, Methods in Mol. Biol. 24: 307-31 (1988); Higgins and Sharp, Gene 73:15 237-44 (1988); Higgins and Sharp, CABIOS 5: 151-3 (1989) Corpet et al., Nuc. Acids Res. 16: 10881-90 (1988); Huang et al., Comp. Appl. BioSci. 8: 155-65 (1992); and Pearson et al. , Meth. Mol. Biol. 24: 307-31 (1994). NCBI's Basic Local Alignment Research Tool (BLAST) [Altschul 20 et al., J. Mol. Biol. 215: 403-10 (1990) J is available from several sources, including the National Center for Biological Information (NBCl, Bethesda, Md.) And on the Internet, for use in connection with the blastp, blasm, blastx sequence analysis programs , tblastn and tblastx. BLAST and a description of how to determine sequence identification using the program can be accessed on the official website of the NCBI (National Biotechnology Information Center) at NIH (National Institute of Health).
[00101] [00101] The recitation of any protein provided in this document covers a functional variant of the protein. The term "functional variant"; of a protein refers to a variant of the protein that retains the ability to be specifically targeted to exosomes.
[00102] [00102] As used in this document, the term "producer cell" refers to a cell used to generate an exosome. A producer cell can be a cell grown in vitro or a cell in vivo. A producer cell includes, but is not limited to, a cell known to be effective in generating exosomes, for example HEK293 cells, Chinese hamster ovary cells (CHO) and mesenchymal stem cells (MSCs).
[00103] [00103] As used in this document, the term "target protein" refers to a protein that can be directed to the surface of an exosome. The target protein can be a non-mutant protein that is naturally directed to an exosome membrane, or a fragment or variant of the non-mutant protein. The target protein can be a fusion protein containing a flag marker, a therapeutic peptide, a targeting fraction or other peptide linked to the non-mutant protein or a non-mutant protein variant or fragment. The target protein can comprise a transmembrane protein, an integral protein, a peripheral protein or a soluble protein attached to the membrane by a linker.
[00104] [00104] As used in this document, the term "contaminating protein" refers to a protein that is not associated with an exosome. For example, a contaminating protein includes a protein, not enclosed in the exosome and not bound or incorporated into the membrane of the exosome.
[00105] [00105] As used in this document, the terms "isolate", "isolated" and "isolating" or "purifying", "purified" and "purifying", as well as "extracted" and "extracting" are used interchangeably and refer to to the state of a preparation (for example, a plurality of known and unknown quantity and / or concentration) of desired EVs, which have undergone one or more purification processes, for example, a selection or enrichment of the desired exosome preparation . In some embodiments, isolating or purifying as used in this document is the process of removing, partially removing (for example, a fraction) the exosomes from a sample containing producer cells. In some embodiments, an isolated exosome composition has no detectable undesirable activity or, alternatively, the level or amount of the undesired activity is equal to or less than an acceptable level or amount. In other embodiments, an isolated exosome composition has a desired amount and / or concentration of exosomes at or above an acceptable amount and / or concentration. In other embodiments, the isolated exosome composition is enriched compared to the starting material (e.g., producer cell preparations) from which the composition is obtained. This enrichment can be 10%, 20%, 30%, 40%, 50%, 60%, 70%, 80%, 90%, 95%, 96%, 97%, 98%, 99%, 99.9 %, 99.99%, 99.999%, 99.9999% or greater than 99.9999% compared to the starting material. In some embodiments, preparations isolated from exosomes are substantially free of residual biological products. In some modalities, isolated exosomal preparations are 100% free, 99% free, 98% free, 97% free, 96% free, 95% free, 94% free, 93% free, 92% free, 91% free or 90 % free of any contaminating biological material. Residual biological products may include abiotic materials (including chemicals) or unwanted nucleic acids, proteins, lipids or metabolites. Substantially free of residual biological products can also mean that the exosome composition does not contain detectable producer cells and that only exosomes are detectable.
[00106] [00106] The term "excipient"; or "carrier"; refers to an inert substance added to a pharmaceutical composition to further facilitate the administration of a compound. The term "pharmaceutically acceptable carrier" or "pharmaceutically acceptable excipient" encompasses any of the agents approved by a US federal government regulatory agency or listed in the US Pharmacopoeia for use on animals, including humans, as well as any carrier or diluent that it does not cause significant irritation to a subject and does not revoke the biological activity and properties of the compound administered. Included are excipients and vehicles that are useful in the preparation of a pharmaceutical composition and are generally safe, non-toxic and desirable.
[00107] [00107] As used in this document, the term "payload" refers to a therapeutic agent that acts on a target (for example, a target cell) that is contacted with the EV. The payloads that can be introduced into an exosome and / or a producing cell include therapeutic agents, such as nucleotides (for example, nucleotides comprising a detectable portion or a toxin or that interrupts transcription), nucleic acids (for example, molecules of DNA or mRNA encoding a polypeptide, such as an enzyme, or RNA molecules that have a regulatory function, such as miRNA, dsDNA, lncRNA and siRNA), amino acids (for example, amino acids comprising a detectable fraction or a toxin or that hinder translation) , polypeptides (for example, enzymes), lipids, carbohydrates, and small molecules (for example, small molecule drugs and toxins).
[00108] [00108] As used in this document, "a mammalian subject" includes all mammals, including, without limitation, humans, domestic animals (eg dogs, cats and the like), farm animals (eg cows, sheep, pigs, horses and the like) and laboratory animals (for example, monkey, rats, mice, rabbits, guinea pigs and the like).
[00109] [00109] The terms "individual", "subject", "host" and "patient" are used interchangeably in this document and refer to any subject for whom the diagnosis, treatment or therapy is desired, particularly humans. The methods described in this document are applicable to both human therapy and veterinary applications. In some modalities, the subject is a mammal and, in other modalities, the subject is a human.
[00110] [00110] As used in this document, the term "substantially free"; means that the sample comprising exosomes comprises less than 10% of macromolecules per percentage concentration of mass / volume (m / v). Some fractions may contain less than 0.001%, less than 0.01%, less than 0.05%, less than 0.1%, less than 0.2%, less than 0.3%, less than 0.4% , less than 0.5%, less than 0.6%, less than 0.7%, less than 0.8%, less than 0.9%, less than 1%, less than 2%, less than 3% , less than 4%, less than 5%, less than 6%, less than 7%, less than 8%, less than 9% or less than 10% (w / v) of macromolecules.
[00111] [00111] As used in this document, the term "macromolecule"; means nucleic acids, contaminating proteins, lipids, carbohydrates, metabolites or a combination thereof.
[00112] [00112] As used in this document, the term "conventional exosomal protein" means a protein previously known to be enriched in exosomes, including, but not limited to, CD9, CD63, CD81, PDGFR, GPI anchoring proteins, LAMP2 and LAMP2B lactaderin , a fragment thereof, or a peptide that binds to it. Other interpretative conventions
[00113] [00113] The ranges recited in this document are understood as a shortcut to all values within the range, including the recited endpoints. For example, a range from 1 to 50 is understood to include any number, combination of numbers, or sub-range of the group consisting of 1, 2, 3, 4, 5, 6, 7, 8, 9, 10, 11, 12 , 13, 14, 15, 16, 17, 18, 19, 20, 21, 22, 23, 24, 25, 26, 27, 28, 29, 30, 31, 32, 33, 34, 35, 36, 37 , 38, 39, 40, 41, 42, 43, 44, 45, 46, 47, 48, 49 and 50. Exosomal Proteins
[00114] [00114] One aspect of the present invention relates to the identification, use and modification of exosomal proteins, which are highly enriched in exosome membranes. Such exosomal proteins can be identified by analyzing highly purified exosomes with mass spectrometry or other methods known in the art.
[00115] [00115] Exosome proteins include various membrane proteins, such as transmembrane proteins, integral proteins and peripheral proteins, enriched in the membranes of the exosome. They include several CD proteins, transporters, integrins, lectins and cadherins. Specifically, proteins include, but are not limited to (1) prostaglandin F2 receptor negative regulator (PTGFRN), (2) basigine (BSG), (3) member of the immunoglobulin 3 (IGSF3) superfamily, (4) member of the immunoglobulin 8 (IGSF8) superfamily, (5) beta-1 integrin (ITGB1), (6) alpha-4 integrin (ITGA4), (7) 4F2 cell surface antigen heavy chain
[00116] [00116] One or more exosomal proteins identified in this document can be used selectively, depending on a producing cell, production condition, purification methods or intended application of exosomes. For example, exosome proteins enriched in a specific population of exosomes can be used to purify the specific population of exosomes. Exosome proteins enriched on the surface of certain exosomes with a specific size range, targeting fraction, charge density, payload, etc. can be identified and used in some embodiments of the present invention. In some embodiments, more than one exosomal protein can be used simultaneously or subsequently for the generation, purification and isolation of therapeutic exosomes. Surface-modified exosomes
[00117] [00117] Another aspect of the present invention concerns the generation and use of surface-modified exosomes. Surface-modified exosomes have a modified membrane in their composition. For example, your membrane compositions can be modified by changing the protein, lipid or glycan content of the membrane.
[00118] [00118] In some modalities, surface-modified exosomes are generated by chemical and / or physical methods, such as PEG-induced fusion and / or ultrasonic fusion.
[00119] [00119] In other modalities, surface-modified exosomes are generated by genetic manipulation. Exosomes produced from a genetically modified producer cell or a progeny from the genetically modified cell may contain modified membrane compositions. In some embodiments, surface-modified exosomes have the exosome protein at a greater or lesser density or include a variant or fragment of the exosome protein.
[00120] [00120] For example, surface-modified exosomes can be produced from a cell transformed with an exogenous sequence encoding the exosome protein or a variant or fragment of the exosome protein. Exosomes including proteins expressed from the exogenous sequence can include modified membrane protein compositions.
[00121] [00121] Various modifications or fragments of the exosome protein can be used for the embodiments of the present invention. For example, proteins modified to have greater affinity for a binding agent can be used to generate surface-modified exosomes that can be purified using the binding agent. Proteins modified to be more effectively targeted to exosomes and / or membranes can be used. Modified proteins can also be used to comprise a minimal fragment necessary for specific and effective targeting to the membranes of the exosome.
[00122] [00122] Fusion proteins can also be used, for example, exosomal proteins or their fragments fused to an affinity marker (e.g., His marker, GST marker, glutathione-S-transferase, S-peptide, HA, Myc, FLAG ™ (Sigma-Aldrich Co.), MBP, SUMO and Protein A) can be used for purification or removal of surface-modified exosomes with a specific binding agent to the affinity marker.
[00123] [00123] Fusion proteins with a therapeutic activity can also be used to generate surface-modified exosomes. For example, the fusion protein can comprise the transporter PTGFRN, BSG, IGSF2, IGSF3, IGSF8, ITGB1, ITGA4, SLC3A2, ATP or a fragment or variant thereof and a therapeutic peptide. The therapeutic peptide is selected from the group consisting of a natural peptide, a recombinant peptide, a synthetic peptide or a linker to a therapeutic compound. The therapeutic compound can be nucleotides, amino acids, lipids, carbohydrates or small molecules. The therapeutic peptide can be an antibody, an enzyme, a linker, a receptor, an antimicrobial peptide or a fragment or variant thereof. In some embodiments, the therapeutic peptide is a nucleic acid-binding protein. The nucleic acid-binding protein can be Dicer, an Argonaute protein, TRBP or bacteriophage coating protein MS2. In some embodiments, the nucleic acid-binding protein additionally comprises one or more RNA or DNA molecules. One or more RNA can be a miRNA, siRNA, guide RNA, lincRNA, mRNA, antisense RNA, dsRNA or combinations thereof.
[00124] [00124] In some embodiments, the therapeutic peptide is a part of a protein-protein interaction system. In some embodiments, the protein-protein interaction system comprises an FRB-FKBP interaction system, for example, the FRB-FKBP interaction system as described in Banaszynski et al., J Am Chem Soc. April 6, 2005; 127 (13): 4715-21.
[00125] [00125] Fusion proteins can be directed to the surface of exosomes and provide therapeutic activity to the exosome. In some embodiments, the fusion protein does not comprise IGSF8 or a fragment or modification thereof.
[00126] [00126] In some embodiments, fusion proteins with a targeting fraction are used. For example, fusion proteins can comprise the transporter PTGFRN, BSG, IGSF2, IGSF3,
[00127] [00127] In some embodiments, the fusion protein does not comprise IGSF8 or a fragment or modification thereof.
[00128] [00128] In some embodiments, the surface-modified exosomes described in this document demonstrate superior characteristics compared to surface-modified exosomes known in the art. For example, surface-modified exosomes produced using the newly identified exosomal proteins provided herein contain modified proteins more highly enriched on their surface than exosomes in the prior art, for example, those produced using conventional exosomal proteins. In addition, the surface-modified exosomes of the present invention may have greater, more specific or more controlled biological activity compared to surface-modified exosomes known in the art. For example, a surface-modified exosome comprising a therapeutic or biologically relevant exogenous sequence fused to an exosomal surface protein or a fragment described in this document (for example, PTGFRN or a fragment thereof) may have more of the desired manipulated characteristics than the fusion for frameworks known in the art. Outline proteins known in the art include tetraspanin molecules (for example, CD63, CD81, CD9 and others), lysosome-associated membrane protein 2 (LAMP2 and LAMP2B), platelet-derived growth factor receptor (PDGFR), proteins anchoring GPI, lactaderine and fragments and peptides that have affinity with any of these proteins or fragments thereof. Previously, overexpression of exogenous proteins depended on the stochastic or random disposition of exogenous proteins in the exosome to produce surface-modified exosomes. This resulted in unpredictable low-level density of exogenous proteins in exosomes. Thus, the exosomal surface proteins and their fragments described in this document provide important advances in new exosome compositions and methods for doing the same.
[00129] [00129] In some embodiments, the surface-modified exosome comprising a fusion protein containing an exogenous sequence and a newly identified exosomal surface protein in this document has a higher density of the fusion protein than similar modified exosomes comprising a sequence exogenous conjugated to a conventional exosomal protein known in the art (for example, CD9, CD63, CD81, PDGFR, GPI anchoring proteins, LAMP2 and LAMP2B lactaderine, a fragment thereof or a peptide that binds to it). In some embodiments, said fusion protein containing an exosome protein in this recently identified document is present in 2-, 4-, 8-, 16-, 32-, 64-, 100-, 200-, 400, 800-, 1,000-fold or higher density on the exosomal surface than fusion proteins on other similarly modified exosomal surfaces using a conventional exosomal protein. In some embodiments, said fusion protein containing an exosomal protein newly identified in this document is present 2 to 4 times, 4 to 8 times, 8 to 16 times, 16 to 32 times, 32 to 64 times, 64 to 100 times , 100 to 200 times, 200 to 400 times, 400 to 800 times, 800 to 1,000 times or at a higher density on the exosomal surface than fusion proteins on other similarly modified exosomal surfaces using a conventional exosomal protein.
[00130] [00130] In some embodiments, a PTGFRN fusion protein, a variant, a fragment, a variant of a fragment or a modification thereof is present in 2-, 4-, 8-, 16-, 32-, 64- , 100-, 200-, 400-, 800-, 1,000- times or a higher density on the exosomal surface than the fusion proteins on other exosomal surfaces modified in the same way using CD9. In some embodiments, a PTGFRN fusion protein, a variant, a fragment, a fragment variant or a modification thereof is present in 2-, 4-, 8-, 16-, 32-, 64-, 100- , 200 -, 400 -, 800 -, 1,000 - times or a higher density on the exosomal surface than the fusion proteins on other exosomal surfaces modified in the same way using CD63. In some embodiments, a PTGFRN fusion protein, a variant, a fragment, a fragment variant or a modification thereof is present in 2-, 4-, 8-, 16-, 32-, 64-, 100- , 200 -, 400 -, 800 -, 1,000 - times or a higher density on the exosomal surface than the fusion proteins on other exosomal surfaces modified in the same way using CD81. In some embodiments, a PTGFRN fusion protein, a variant, a fragment, a fragment variant or a modification thereof is present in 2-, 4-, 8-, 16-, 32-, 64-, 100- , 200 -, 400 -, 800 -, 1,000 - times or a higher density on the exosomal surface than the fusion proteins on other exosomal surfaces modified in the same way using PDGFR.
[00131] [00131] In particular embodiments, a PTGFRN fusion protein, a variant, a fragment, a variant of a fragment or a modification thereof is present in 2-, 4-, 8-, 16-, 32-, 64- , 100-, 200-, 400-, 800-, 1,000- times or a higher density on the exosomal surface than fusion proteins on other similarly modified exosomal surfaces using a conventional exosomal protein (for example, a molecule of tetraspanin, such as CD63). In particular embodiments, a BSG fusion protein, a variant, a fragment, a variant of a fragment or a modification thereof is present in 2-, 4-, 8-, 16-, 32-, 64-, 100- , 200-, 400-, 800-, 1,000- times or a higher density on the exosomal surface than fusion proteins on other similarly modified exosomal surfaces using a conventional exosomal protein (for example, a tetraspanin molecule, such as CD63). In particular embodiments, an IGSF2 fusion protein, a variant, a fragment, a fragment variant or a modification thereof is present in 2-, 4-, 8-, 16-, 32-, 64-, 100- , 200-, 400-, 800-, 1,000- times or a higher density on the exosomal surface than fusion proteins on other similarly modified exosomal surfaces using a conventional exosomal protein (for example, a tetraspanin molecule, such as CD63). In particular embodiments, an IGSF3 fusion protein, a variant, a fragment, a variant of a fragment or a modification thereof is present in 2-, 4-, 8-, 16-, 32-, 64-, 100- , 200-, 400-, 800-, 1,000- times or a higher density on the exosomal surface than fusion proteins on other similarly modified exosomal surfaces using a conventional exosomal protein (for example, a tetraspanin molecule, such as CD63). In particular embodiments, an IGSF8 fusion protein, a variant, a fragment, a fragment variant or a modification thereof is present in 2-, 4-, 8-, 16-, 32-, 64-, 100- , 200-, 400-, 800-, 1,000- times or a higher density on the exosomal surface than fusion proteins on other similarly modified exosomal surfaces using a conventional exosomal protein (eg, a tetraspanin molecule , such as CD63). In particular embodiments, an ITGB1 fusion protein, a variant, a fragment, a variant of a fragment or a modification thereof is present in 2-, 4-, 8-, 16-, 32-, 64-, 100- , 200-, 400-, 800-, 1,000- times or a higher density on the exosomal surface than fusion proteins on other similarly modified exosomal surfaces using a conventional exosomal protein (for example, a tetraspanin molecule, such as CD63). In particular modalities,
[00132] [00132] The fusion proteins provided in this document may comprise PTGFRN, BSG, IGSF2, IGSF3, IGSF8, ITGB1, ITGA4, SLC3A2, ATP carrier or a fragment or variant thereof and an additional peptide. The additional peptide can be attached to the N-terminus or the C-terminus of the exosomal protein or to a fragment or variant thereof. The additional peptide can be located inside (on the luminal side) or outside the exosome attached to the exosomal protein.
[00133] [00133] In some embodiments, the fusion proteins provided in this document may comprise PTGFRN, BSG, IGSF2, IGSF3, IGSF8, ITGB1, ITGA4, SLC3A2, ATP carrier or a fragment or variant thereof and two additional peptides. Both additional peptides can be attached to the N-terminus or the C-terminus of the exosomal protein or to a fragment or variant thereof. In some embodiments, one of the two additional peptides is attached to the N-terminus and the other of the two additional peptides is attached to the C-terminus of the exosomal protein or to a fragment or variant thereof. The additional peptide can be located inside (on the luminal side) or outside the exosome linked to the exosomal protein, or both. Producing Cell for Production of Modified Surface Exosomes
[00134] [00134] The exosomes of the present invention can be produced from a cell grown in vitro or from a subject's body fluid. When exosomes are produced from cell culture in vitro, several producer cells, for example HEK293 cells, Chinese hamster ovary cells (CHO) or mesenchymal stem cells (MSCs), can be used for the present invention.
[00135] [00135] The producer cell can be genetically modified to comprise one or more exogenous sequences to produce surface-modified exosomes. The genetically modified producer cell may contain the exogenous sequence introduced by transient or stable transformation. The exogenous sequence can be introduced into the producer cell as a plasmid. Exogenous sequences can be stably integrated into a genomic sequence in the producing cell, at a target site, or at a random location. In some embodiments, a stable cell line is generated to produce surface-modified exosomes.
[00136] [00136] The exogenous sequences can be inserted into a genomic sequence of the producing cell, located inside, upstream (5 'end) or downstream (3' end) of an endogenous sequence that encodes the exosomal protein. Various methods known in the art can be used to introduce exogenous sequences into the producer cell. For example, cells modified using various gene editing methods (for example, methods using homologous recombination, transposon-mediated system, loxP-Cre system, CRISPR / Cas9 or TALEN) are within the scope of the present invention.
[00137] [00137] Exogenous sequences may comprise a sequence encoding the exosomal protein or a variant or fragment of the exosomal protein. An extra copy of the sequence encoding the exosomal protein can be introduced to produce a surface exosome modified with the exosomal protein at a higher density. An exogenous sequence that encodes a variant or fragment of the exosomal protein can be introduced to produce a surface-modified exosome containing the modification or fragment of the exosomal protein. An exogenous sequence encoding an affinity marker can be introduced to produce a surface-modified exosome containing a fusion protein comprising the affinity marker attached to the exosomal protein.
[00138] [00138] In some embodiments, a surface-modified exosome has a higher density of the exosomal protein than native exosomes isolated from the same or similar types of producer cells. In some embodiments, said exosomal protein is present in 2-, 4-, 8-, 16-, 32-, 64-, 100-, 200-, 400-, 800-, 1,000- times or at a higher density in said surface-modified exosome than said native exosome. In some embodiments, said exosomal protein is present 2 to 4 times, 4 to 8 times, 8 to 16 times, 16 to 32 times, 32 to 64 times, 64 to 100 times, 100 to 200 times, 200 to 400 times , 400 to 800 times, 800 to 1,000 times or at a higher density in said surface-modified exosome than said native exosome. In some embodiments, a fusion protein comprising the exosomal protein is present 2 to 4 times, 4 to 8 times, 8 to 16 times, 16 to 32 times, 32 to 64 times, 64 to 100 times, 100 to 200 times, 200 to 400 times, 400 to 800 times, 800 to 1,000 times or at a higher density in said surface-modified exosome than the unmodified exosomal protein in said native exosome. In some embodiments, a fragment or variant of the exosomal protein is present 2 to 4 times, 4 to 8 times, 8 to 16 times, 16 to 32 times, 32 to 64 times, 64 to 100- one fold, 100 to 200 times 200 to 400 times, 400 to 800 times, 800 to 1,000 times or at a higher density in said surface-modified exosome than the unmodified exosomal protein in said native exosome.
[00139] [00139] In particular modalities, PTGFRN, a fragment or variant of PTGFRN or a modification thereof is present 2 to 4 times, 4 to 8 times, 8 to 16 times, 16 to 32 times, 32 to 64 times, 64 100 times, 100 to 200 times, 200 to 400 times, 400 to 800 times, 800 to 1,000 times or at a higher density in said surface-modified exosome than unmodified PTGFRN in said native exosome. In particular embodiments, BSG, a fragment or variant of BSG, or a modification thereof is present 2 to 4 times, 4 to 8 times, 8 to 16 times, 16 to 32 times, 32 to 64 times, 64 to 100 times, 100 to 200 times, 200 to 400 times, 400 to 800 times, 800 to 1,000 times or at a higher density in said surface-modified exosome than the unmodified BSG in said native exosome.
[00140] [00140] In some embodiments, the producer cell is further modified to comprise an additional exogenous sequence. For example, an additional exogenous sequence can be introduced to modulate endogenous gene expression or to produce an exosome including a certain polypeptide as a payload. In some embodiments, the producing cell is modified to comprise two exogenous sequences, one that encodes the exosomal protein or a variant or fragment of the exosomal protein and the other that encodes a payload. In some embodiments, the producing cell can be further modified to comprise an additional exogenous sequence that gives additional functionality to the exosomes, for example, specific targeting capabilities, delivery functions, enzymatic functions, increased or decreased half-life in vivo, etc. In some embodiments, the producing cell is modified to comprise two exogenous sequences, one that encodes the exosomal protein or a variant or fragment of the exosomal protein and the other that encodes a protein that gives additional functionality to the exosomes.
[00141] [00141] In some embodiments, the producing cell is modified to comprise two exogenous sequences, each of the two exogenous sequences that encode a fusion protein on the exosomal surface. In some embodiments, a surface-modified exosome of the producing cell has a higher density of an exosomal protein compared to native exosomes isolated from an unmodified cell of the same or similar cell type. In some embodiments, the surface-modified exosome contains an exosomal protein in densities 2-, 4-, 8-, 16-, 32-, 64-, 100-, 200-, 400-, 800-, 1,000- times or more than a native exosome isolated from an unmodified cell of the same or similar cell type. In some embodiments, the producer cell is further modified to comprise one, two, three, four, five, six, seven, eight, nine or ten or more additional exogenous sequences.
[00142] [00142] More specifically, surface-modified exosomes can be produced from a cell transformed with a sequence encoding one or more exosomal surface proteins or a variant thereof, including, but not limited to (1) negative regulator of prostaglandin F2 receptor (PTGFRN), (2) basigin (BSG), (3) member of the immunoglobulin 3 (IGSF3) superfamily, (4) member of the immunoglobulin 8 (IGSF8) superfamily, (5) beta-1 integrin ( ITGB1), (6) alpha-4 integrin (ITGA4), (7) 4F2 cell surface antigen heavy chain (SLC3A2), (8) a class of ATP carrier proteins (ATP1A1, ATP1A2, ATP1A3, ATP1A4, ATP1B3, ATP2B1, ATP2B2, ATP2B3, ATP2B4) and (9) member of the immunoglobulin 2 (IGSF2) superfamily. Any of the one or more exosomal surface proteins described in this document can be expressed in the producing cell from a plasmid, an exogenous sequence inserted into the genome or another exogenous nucleic acid, such as a synthetic messenger RNA (mRNA).
[00143] [00143] In some embodiments, one or more exosomal surface proteins are expressed in a cell transformed with an exogenous sequence that encodes its endogenous full-length form. In some embodiments, this exogenous sequence encodes the PTGFRN protein of SEQ ID NO: 1. In some embodiments, this exogenous sequence encodes the BSG protein of SEQ ID NO: 9. In some embodiments, this exogenous sequence encodes the IGSF8 protein of SEQ ID NO: 14. In some embodiments, this exogenous sequence encodes the IGSF3 protein of SEQ ID NO: 20. In some embodiments, this exogenous sequence encodes the ITGB1 protein of SEQ ID NO: 21. In some embodiments, this exogenous sequence encodes the ITGA4 protein of SEQ ID NO: 22. In some embodiments, this exogenous sequence encodes the SLC3A2 protein of SEQ ID NO: 23. In some embodiments, this exogenous sequence encodes the ATP1A1 protein of SEQ ID NO: 24. In some embodiments, this exogenous sequence encodes the ATP1A2 protein of SEQ ID NO: 25. In some embodiments, this exogenous sequence encodes the ATP1A3 protein of SEQ ID NO: 26. In some embodiments, this exogenous sequence encodes the ATP1A4 protein of SEQ ID NO: 27. In some embodiments, this exogenous sequence encodes the ATP1B3 protein of SEQ ID NO: 28. In some embodiments, this exogenous sequence encodes the ATP2B1 protein of SEQ ID NO: 29. In some embodiments, this exogenous sequence encodes the ATP2B2 protein of SEQ ID NO: 30. In some embodiments, this exogenous sequence encodes the ATP2B3 protein of SEQ ID NO: 31. In some embodiments, this exogenous sequence encodes the ATP2B4 protein of SEQ ID NO: 32. In some embodiments, this exogenous sequence encodes the IGSF2 protein from
[00144] [00144] Surface-modified exosomes can be produced from a cell transformed with a sequence that encodes a fragment of one or more exosomal surface proteins, including, but not limited to (1) the negative regulator of the F2 prostaglandin receptor ( PTGFRN), (2) basigine (BSG), (3) member of the immunoglobulin 3 (IGSF3) superfamily, (4) member of the immunoglobulin 8 (IGSF8) superfamily, (5) beta-1 (ITGB1) integrin, (6 ) alpha-4 integrin (ITGA4), (7) 4F2 cell surface antigen heavy chain (SLC3A2), (8) a class of ATP carrier proteins (ATP1A1, ATP1A2, ATP1A3, ATP1A4, ATP1B3, ATP2B1, ATP2B2, ATP2B3 , ATP2B4) and (9) member of the immunoglobulin 2 (IGSF2) superfamily. In some embodiments, the sequence encodes a fragment of the exosomal surface protein without at least 5, 10, 50, 100, 200, 300, 400, 500, 600, 700 or 800 amino acids from the N-terminus of the native protein. In some embodiments, the sequence encodes a fragment of the exosomal surface protein without at least 5, 10, 50, 100, 200, 300, 400, 500, 600, 700, or 800 C-terminal amino acids from the native protein. In some embodiments, the sequence encodes a fragment of the exosomal surface protein without at least 5, 10, 50, 100, 200, 300, 400, 500, 600, 700 or 800 amino acids from both the N-terminus and the C-terminus of the native protein. In some embodiments, the sequence encodes a fragment of the exosomal surface protein without one or more functional or structural domains of the native protein.
[00145] [00145] In some embodiments, the exosomal surface protein fragment is fused with one or more heterologous proteins. In some embodiments, one or more heterologous proteins are fused to the N-terminus of the fragment. In some embodiments, one or more heterologous proteins are fused to the C-terminus of the fragment. In some embodiments, one or more heterologous proteins are fused to the N-terminus and the C-terminus of the fragment. In some embodiments, the one or more heterologous proteins are mammalian proteins. In some embodiments, one or more heterologous proteins are human proteins.
[00146] [00146] Surface-modified exosomes can be produced from a cell transformed with a sequence that encodes fragments of PTGFRN. In some embodiments, PTGFRN fragments do not have one or more functional or structural domains, such as IgV. For example, the PTGFRN fragment can comprise a polypeptide of SEQ ID NO: 2-7 or 33. In some embodiments, the PTGFRN fragments are fused to one or more heterologous proteins. The one or more heterologous proteins can be fused to the N-terminus of said PTGFRN fragments. The one or more heterologous proteins can be fused to the C-terminus of said PTGFRN fragments. In some embodiments, the one or more heterologous proteins are fused to the N-terminus and the C-terminus of said PTGFRN fragments. In some embodiments, the heterologous protein is a mammalian protein. In some embodiments, the heterologous protein is a human protein. In some embodiments, said heterologous protein fused to said PTGFRN fragment additionally contains a signal sequence peptide. The signal sequence peptide can be a polypeptide of SEQ ID NO: 8.
[00147] [00147] Surface-modified exosomes can be produced from a cell transformed with a sequence encoding Basigin fragments. In some modalities, Basigina fragments do not have one or more functional or structural domains, such as IgV. For example, Basigin fragments can comprise a polypeptide of SEQ ID NO: 10-12. In some embodiments, the Basigina fragments are fused with one or more heterologous proteins. In some embodiments, the one or more heterologous proteins are fused to the N-terminus of said Basigin fragments. In some embodiments, the one or more heterologous proteins are fused to the C-terminus of said Basigin fragments. In some embodiments, the one or more heterologous proteins are fused to the N-terminus and the C-terminus of said Basigin fragments. In some embodiments, the heterologous protein is a mammalian protein. In some embodiments, the heterologous protein is a human protein. In some embodiments, said heterologous protein fused to said Basigin fragment additionally contains a signal sequence peptide. The signal sequence peptide can be a polypeptide of SEQ ID NO: 13.
[00148] [00148] Surface-modified exosomes can be produced from a cell transformed with a sequence that encodes fragments of IGSF8. In some embodiments, the IGSF8 fragments do not have one or more functional or structural domains, such as IgV. For example, the IGSF8 fragments can comprise a polypeptide of SEQ ID NO: 15-18. In some embodiments, the IGSF8 fragments are fused with one or more heterologous proteins. In some embodiments, the one or more heterologous proteins are fused to the N-terminus of said IGSF8 fragments. In some embodiments, the one or more heterologous proteins are fused to the C-terminus of said IGSF8 fragments. In some embodiments, the one or more heterologous proteins are fused to the N-terminus and the C-terminus of said IGSF8 fragments. In some embodiments, the heterologous protein is a mammalian protein. In some embodiments, the heterologous protein is a human protein. In some embodiments, said heterologous protein fused to said IGSF8 fragment additionally contains a signal sequence peptide. The signal sequence peptide can be a polypeptide of SEQ ID NO: 19.
[00149] [00149] Surface-modified exosomes can be produced from a cell transformed with a sequence that encodes fragments of IGSF2. In some embodiments, the IGSF2 fragments do not have one or more functional or structural domains, such as IgV. In some embodiments, the IGSF2 fragments are fused to one or more heterologous proteins. In some embodiments, the one or more heterologous proteins are fused to the N-terminus of said IGSF2 fragments. In some embodiments, the one or more heterologous proteins are fused to the C-terminus of said IGSF2 fragments. In some embodiments, the one or more heterologous proteins are fused to the N-terminus and the C-terminus of said IGSF2 fragments. In some embodiments, the heterologous protein is a mammalian protein. In some embodiments, the heterologous protein is a human protein. In some embodiments, said heterologous protein fused to said IGSF2 fragment additionally contains a signal sequence peptide. The signal sequence peptide can be a polypeptide of SEQ ID NO: 35.
[00150] [00150] In some embodiments, surface-modified exosomes comprise a polypeptide of an identical or similar full-length sequence or a fragment of a native exosomal surface protein, including, but not limited to, the (1) negative receptor regulator prostaglandin F2 (PTGFRN), (2) basigine (BSG), (3) member of the immunoglobulin 3 (IGSF3) superfamily, (4) member of the immunoglobulin 8 (IGSF8) superfamily, (5) beta-1 integrin (ITGB1 ), (6) alpha-4 integrin (ITGA4), (7) 4F2 cell surface antigen heavy chain (SLC3A2), (8) a class of ATP carrier proteins (ATP1A1, ATP1A2, ATP1A3, ATP1A4, ATP1B3, ATP2B1 , ATP2B2,
[00151] [00151] Some embodiments of the present invention relate to the isolation, purification and subfractionation of exosomes using a specific binding interaction between a protein enriched in the exosomal membrane and an immobilized binding agent. These methods generally comprise the steps of (1) applying or loading a sample comprising exosomes, (2) optionally washing the unbound sample components, using appropriate buffers that maintain the binding interaction between the exosome target proteins and binding agents and (3) elute (dissociation and recovery) of the exosomes of the immobilized binding agents, changing the buffer conditions so that the binding interaction no longer occurs.
[00152] [00152] Some modalities refer to a method of removing exosomes from a sample using a specific binding interaction between a protein enriched in the exosomal membrane and an immobilized binding agent. In cases, exosomes bound to the binding agent are not eluted from the binding agent and a fraction that does not bind to the binding agent can be collected. The method can be used to purify a sample comprising exosomes and a non-exosomal material, such as a virus (for example, lentivirus, retrovirus, adeno-associated virus or any other wrapped or unshielded virus) or a recombinant protein (for example, antibodies, enzymes or other polypeptides), where exosomes are contaminating particles. Bound exosomes can be retained bound to the binding agent and non-exosomal material is collected, substantially free of exosomes.
[00153] [00153] The target protein, used for this process of isolation, purification, subfractionation or removal, can be an endogenous protein produced from the genome of a producing cell, a protein introduced into the producing cell by a genetic modification or a modified protein by chemical substances, physical methods or other biological methods. In some cases, the protein is a non-mutant protein or a mutant protein, for example, a variant or fragment of an endogenous protein. In some cases, the protein is a fusion protein.
[00154] [00154] Various binding agents having affinity for the target protein can be used for the embodiments of the present invention. For example, proteins, peptides and small molecules with specific affinities for the target protein can be used as a binding agent. In some embodiments, the binding agents are obtained from organic or inorganic sources. Examples of binding agents from organic sources include serum proteins, lectins or antibodies. Examples of binding agents from inorganic sources include boronic acids, metal chelates and triazine dyes.
[00155] [00155] The binding agents can be chemically immobilized or coupled to a solid support, so that exosomes with specific affinity to the binding agent are bound. Various forms of solid support can be used, for example, a porous agarose sphere, a microtiter plate, a magnetic sphere or a membrane. In some embodiments, the solid support forms a chromatography column and can be used for exosome affinity chromatography.
[00156] [00156] In some cases, the isolation, purification, subfractionation and removal of exosomes are done by column chromatography using a column where the binding agents and the solid support are compacted. In some embodiments, a sample containing exosomes travels the column to allow configuration, a wash buffer travels the column and the elution buffer subsequently applied to the column and collected. These steps can be performed at ambient pressure or with the application of additional pressure.
[00157] [00157] In some cases, isolation, purification, subfractionation and removal of exosomes are done using a batch treatment. For example, a sample is added to the bonding agent attached to a solid support in a container, mixing, separating the solid support, removing the liquid phase, washing, centrifuging, adding the elution buffer, recentrifuging and removing the elute.
[00158] [00158] In some cases, a hybrid method can be employed. For example, a sample is added to the binding agent attached to a solid support in a vessel, the solid support bound to the exosomes is subsequently packaged in a column and washing and eluting are done on the column.
[00159] [00159] In some cases, isolation, purification, subfractionation and removal of exosomes are done using a bonding agent attached to microtiter plates, magnetic spheres or membranes. In these cases, a sample is added to the bonding agent attached to a solid support, followed by the mixing steps, separating the solid support, removing the liquid phase, washing, removing the wash buffer, adding the elution buffer and removing the eluate. .
[00160] [00160] The binding between the binding agent and a target protein in the exosome is made under several physiological conditions ideal for specific interactions between the binding agent and the target protein in the exosome. The elution of bound exosomes can be achieved by changing the concentrations of salt, pH, pi, charge and ionic strength directly or through a gradient.
[00161] [00161] In some embodiments, an isolated, purified or subfractionated sample with a binding agent is subsequently processed with a different binding agent.
[00162] [00162] In some embodiments, more than one column is used in series, where each of the multiple columns contains a different binding agent specific to a different target protein.
[00163] [00163] In some embodiments, a single column contains several binding agents, each specific for a different target protein.
[00164] [00164] In some cases, the bonding agent and the solid support are reused by introducing a periodic cleaning step. For example, they can be sanitized with a combination of propylene glycol, isopropanol, high ionic strength and / or sodium hydroxide. Sample preparation
[00165] [00165] The methods described in this document can be used to purify, isolate, subfraction or remove exosomes from various samples comprising exosomes. In some embodiments, the sample is an enlightened collection material containing exosomes. In some cases, the sample comprises exosomes partially purified by a purification method well known in the art. For example, ultrafiltration / diafiltration, hydroxyl apatite chromatography, hydrophobic interaction chromatography, deep filtration or ion exchange / elution chromatography can be used to partially purify exosomes before applying to a binding agent for affinity purification.
[00166] [00166] In some cases, the partially purified material is further processed to have certain physiological conditions (for example, pH, temperature, salt concentration, type of salt, polarity) for the desired interaction with the binding agent. A sample can be prepared by dilution or concentration to obtain certain concentrations of exosomes, or by adding excipients to change the structure of the exosomes. In some cases, the partially purified material is applied to the binding agent without any manipulation. Link
[00167] [00167] The methods described in this document require specific interaction between an exosome target protein and a binding agent. High-throughput screening can be performed to identify ideal buffer conditions for specific binding - changing salt concentration, pH and / or reducing polarity with an organic modifier, ethylene glycol, propylene glycol or urea. The interaction between a target protein and a binding agent can also change depending on the sample conditions (for example, amount of sample loaded per volume of chromatographic resin, concentration of exosomes, concentration of impurities), loading buffers (for example, pH , salt concentrations, types of salt, polarity) and other physical conditions (for example, temperature). In addition, the addition of excipients that alter the structure of exosomes can also alter their interactions. In addition, the residence time can be adjusted based on the rates of differential adsorption between impurities and exosomes. Thus, several purification conditions described in this document can be tested to identify ideal conditions for the step.
[00168] [00168] Similar approaches can be used to improve purity and yield, in addition to assisting in the enrichment, depletion or isolation of sub-populations of exosomes. These properties, together with the maximization of the load challenge and the application of more stringent elution conditions, could be used to further increase the concentration of exosomes. Elution
[00169] [00169] The elution of exosomes can be achieved by changing the concentration of salt, pH and / or polarity with an organic modifier, ethylene glycol, propylene glycol or urea.
[00170] [00170] Selective elution of exosomes can be achieved by increasing the concentration of a monovalent cationic halide salt (for example, sodium chloride, potassium chloride, sodium bromide, lithium chloride, sodium iodide, potassium bromide, bromide lithium, sodium fluoride, potassium fluoride, lithium fluoride,
[00171] [00171] Substantial purity of the exosome can be achieved by flowing through impurities during the column loading phase, eluting impurities during selective excipient washes and selectively eluting the product during elution, leaving additional impurities attached to the column. The absorbance measured from the column eluates may indicate the purification of the exosomes obtained by the methods.
[00172] [00172] Elution can also be achieved by modulating the pH range, salts, organic solvents, small molecules, detergents, zwitterions, amino acids, polymers, temperature and any combination of the above. Similar eluting agents can be used to improve purity, improve yield and isolate subpopulations of exosomes.
[00173] [00173] Elution can also be done with several elution buffers with different properties, such as pH, salts, organic solvents, small molecules, detergents, zwitterions, amino acids, polymers, temperature and any combination of the above. A plurality of eluted fractions can be collected, in which the exosomes collected in each fraction have different properties. For example, exosomes collected in a fraction have a higher purity, a smaller or larger average size, a preferred composition, etc. than exosomes in other fractions.
[00174] [00174] Elution buffers with different properties can be applied as a continuous flow, while a plurality of eluted fractions are collected. Eluted fractions can be collected during isocratic elution or gradient elution. Once at least one eluted fraction is collected, a composition of the eluted fraction can be analyzed. For example, the concentration of exosomes, a host cell protein, a contaminating protein, DNA, carbohydrates or lipids can be measured in each fraction eluted. Other properties of exosomes in each eluted fraction can also be measured. Properties include medium size, medium charge density and other physiological properties related to biodistribution, cell uptake, half-life, pharmacodynamics, potency, dosage, immune response, charge efficiency, stability or reactivity to other compounds. Washing
[00175] [00175] Optionally, the purity of the exosomes can be improved by washing the samples before elution. In some embodiments, the excipient may be a wash buffer. The excipient can be a solution with specific pH ranges, salts,
[00176] [00176] More specifically, the excipient may comprise arginine, lysine, glycine, histidine, calcium, sodium, lithium, potassium, iodide, magnesium, iron, zinc, manganese, urea, propylene glycol, aluminum, ammonium, polyethylene glycol guanidinium, EDTA , EGTA, a detergent, chloride, sulfate, carboxylic acids, sialic acids, phosphate, acetate, glycine, borate, format, perchlorate, bromine, nitrate, dithiothreitol, beta mercaptoethanol or tri-n-butyl phosphate.
[00177] [00177] The excipient may also comprise a detergent, selected from the group consisting of cetyl trimethylammonium chloride, octoxynol-9, TRITONTM X-100 (ie, polyethylene glycol p- (1,1,3,3- tetramethylbutyl) -phenyl ether) and TRITONTM CG-110 available from Sigma-Aldrich; sodium dodecyl sulfate; Sodium lauryl sulfate; deoxycholic acid; Polysorbate 80 (i.e., polyoxyethylene (20) sorbitan monooleate); Polysorbate 20 (i.e., polyoxyethylene (20) sorbitan monolaurate); alcohol ethoxylate; alkylpolyethylene glycol ether; decyl glucoside; octoglucosides; SafeCare; ECOSURFTM EH9, ECOSURFTMEH6, ECOSURFTM EH3, ECOSURFTM SA7, and ECOSURFTM SA9 available from DOW Chemical; LUTENSOLTM M5, LUTENSOLTM XL, LUTENSOLTM XP and APGTM 325N available from BASF; TOMADOLTM 900 available from AIR PRODUCTS; NATSURFTM 265 available from CRODA; SAFECARETM1000 available from Bestchem, TERGITOLTM L64 available from DOW; caprylic acid; CHEMBETAINETM LEC available from Lubrizol; and Mackol DG. Other methods to improve the result
[00178] [00178] The amount of exosomes that can be loaded per volume of chromatographic resin can be improved by modulating the feed material, for example, increasing the concentration of exosomes, decreasing the concentration of impurities, changing the pH, decreasing the salt concentrations, decreasing ionic forces or altering specific subpopulations of exosomes. Due to mass transfer restrictions and slow adsorption and desorption of exosomes in the resin, the amount of exosomes that can be loaded per volume of chromatographic resin can be increased by decreasing the flow rate during column loading, using longer columns to increase the length of stay.
[00179] [00179] The use of exosomes for medical purposes requires that the exosomes are free or mainly free of impurities, including but not limited to macromolecules, such as nucleic acids, contaminating proteins, lipids, carbohydrates, metabolites, small molecules, metals or a combination of the same. The present invention provides a method for purifying exosomes from contaminating macromolecules. In some embodiments, the purified exosomes are substantially free of contaminating macromolecules.
[00180] [00180] Modalities of the present invention further provide methods for subfractionated populations of exosomes based on their membrane protein, size, charge density, type of ligand (e.g., tetraspanins) and heparin or other sulfated carbohydrate binding sites. The choice of the affinity marker, load and elution buffer compositions and protocols can result in the elution of different subpopulations of exosomes.
[00181] [00181] For example, embodiments of the present invention provide methods for purifying a population of exosomes of a smaller or larger size. The size of the exosomes can be determined by the methods available in the field. For example, size can be measured by nanoparticle tracking analysis, multiple angle light scattering, single angle light scattering, size exclusion chromatography, analytical ultracentrifugation, field flow fractionation, laser diffraction, sensor adjustable resistive pulse or dynamic light scattering.
[00182] [00182] Modalities of the present invention also refer to methods of subfractionated exosomes based on their charge density. The charge density of the exosomes can be determined by potentiometric titration, anion exchange, cation exchange, isoelectric focus, zeta potential, capillary electrophoresis, capillary zone electrophoresis, gel electrophoresis.
[00183] [00183] Modalities of the present invention also refer to subfractionated exosomes based on other physiological properties, such as biodistribution, cell uptake, half-life, pharmacodynamics, potency, dosage, immune response, loading efficiency, stability or reactivity to other compounds. The method allows the isolation of a population of exosomes suitable for a specific application.
[00184] [00184] In some modalities, the methods in this document described also include the step of characterizing exosomes contained in each fraction collected. In some modalities, the content of the exosomes can be extracted for study and characterization. In some embodiments, exosomes are isolated and characterized by metrics, including, but not limited to, size, shape, morphology or molecular compositions, such as nucleic acids, proteins, metabolites and lipids.
[00185] [00185] Exosomes can include proteins, peptides, RNA, DNA and lipids. Total RNA can be extracted using acid-phenol: chloroform extraction. The RNA can then be purified using a glass fiber filter under conditions that recover small RNA containing total RNA or that separate small RNA species less than 200 nucleotides in length from longer RNA species, such as mRNA. Since the RNA is eluted in a small volume, no alcohol precipitation step may be necessary to isolate the RNA.
[00186] [00186] Exome compositions can be evaluated by methods known in the art, including, but not limited to, transcriptomics, sequencing, proteomics, mass spectrometry or HP-LC.
[00187] [00187] The composition of nucleotides associated with isolated exosomes (including RNAs and DNAs) can be measured using a variety of techniques that are well known to those skilled in the art (for example, quantitative or semi-quantitative RT-PCR, Northern blot analysis, solution hybridization detection). In a specific embodiment, the level of at least one RNA is measured by the RNA reverse transcription of the exosome composition to provide a set of target oligodeoxynucleotides, hybridizing the target oligodeoxynucleotides to one or more oligonucleotides from the RNA-specific probe (for example, one RNA-specific probe) microarray comprising RNA-specific oligonucleotide probes) to provide a hybridization profile for the exosome composition and to compare the hybridization profile of the exosome composition with a hybridization profile generated from a control sample. A change in signal from at least one RNA in the test sample relative to the control sample is indicative of the RNA composition.
[00188] [00188] In addition, a microarray can be prepared from gene-specific oligonucleotide probes generated from known RNA sequences. The matrix can contain two different oligonucleotide probes for each RNA, one containing the mature active sequence and the other specific for the RNA precursor (for example, miRNA and pre-miRNAs). The matrix can also contain controls, such as one or more mouse sequences that differ from human orthologists by only a few bases, which can serve as controls for stringent hybridization conditions. The tRNAs and other RNAs (for example, rRNAs, mRNAs) from both species can also be printed on the microchip, providing a relatively stable internal positive control for specific hybridization. One or more controls suitable for non-specific hybridization can also be included in the microchip. For this purpose, sequences are selected based on the absence of any homology to any known RNA.
[00189] [00189] The microarray can be manufactured using techniques known in the art. For example, probe oligonucleotides of appropriate length, for example, 40 nucleotides, are modified into 5'-amine at the C6 position and printed on activated slides using commercially available microarray systems, for example, the GeneMachine OmniGrid. TM. 100 Microarrayer and Amersham CodeLink. TM. The labeled cDNA oligomer corresponding to the target RNAs is prepared by reverse transcribing the target RNA with the labeled primer. After synthesis of the first strand, the RNA / DNA hybrids are denatured to degrade the RNA models. The tagged target cDNAs thus prepared are then hybridized to the microarray chip under hybridization conditions, for example, 6 times. 30% SSPE / formamide at 25 ° C for 18 hours, followed by washing at 0.75x. TNT at 37 ° C. for 40 minutes. In positions in the array where the DNA of the immobilized probe recognizes a complementary target cDNA in the sample, hybridization occurs. The marked target cDNA marks the exact position in the matrix where the binding occurs, allowing automatic detection and quantification. The output consists of a list of hybridization events, indicating the relative abundance of specific cDNA sequences and, therefore, the relative abundance of the corresponding complementary RNAs, in the exosome preparation. According to one embodiment, the labeled cDNA oligomer is a biotin-labeled cDNA, prepared from a biotin-labeled primer. The microarray is then processed by direct detection of biotin-containing transcripts using, for example, Streptavidin-Alexa647 conjugate, and scanned using conventional scanning methods. The image intensities of each point in the array are proportional to the abundance of the corresponding RNA in the exosome.
[00190] [00190] The data mining work is completed by bioinformatics, including scanning chips, signal acquisition, image processing, standardization, statistical treatment and data comparison, as well as path analysis. As such, the microarray can trace hundreds and thousands of polynucleotides simultaneously with high yield performance. The microarray profile analysis of mRNA expression has successfully provided valuable data for studies of gene expression in basic research. And the technique was even more put into practice in the pharmaceutical industry and in clinical diagnosis. With the increase in the amount of miRNA data available and the accumulation of evidence of the importance of miRNA in gene regulation, the microarray becomes a useful technique for high performance miRNA studies. Analysis of miRNA levels using polynucleotide probes can also be performed in a variety of physical formats such as a well. For example, the use of microtiter or automation plates can be used to facilitate the processing of a large number of test samples.
[00191] [00191] In some embodiments, the methods described in this document include measuring the size of exosomes and / or populations of exosomes included in the purified fractions. In some modalities, the size of the exosome is measured as the largest measurable dimension. Generally, the longest overall dimension of an exosome is also called a diameter.
[00192] [00192] The size of the exosome can be measured using various methods known in the art, for example, nanoparticle tracking analysis, light scattering from various angles, single angle light scattering, size exclusion chromatography, analytical ultracentrifugation, fractionation field flow, laser diffraction, tunable resistive pulse sensor, or dynamic light scattering.
[00193] [00193] The size of the exosome can be measured using dynamic light scattering (DLS) and / or multiangular light scattering (MALS). Methods of using DLS and / or MALS to measure the size of exosomes are known to those skilled in the art and include the nanoparticle tracking assay (NTA, for example, using a Malvern Nanosight NS300 nanoparticle tracking device). In a specific embodiment, the size of the exosome is determined using a Malvern NanoSight NS300. In some embodiments, the exosomes described in this document have a longer dimension of about 20-1000 nm, as measured by the NTA (for example, using a Malvern NanosightNS300). In other embodiments, the exosomes described in this document have a longer dimension of about 40-1000 nm, as measured by the NTA (for example, using a Malvern NanosightNS300). In other embodiments, the exosome populations described in this document comprise a population, where 90% of said exosomes have a longer dimension of about 20-1000 nm, as measured by the NTA (for example, using a Malvern Nanosight NS300). In other embodiments, the exosome populations described in this document comprise a population, where 95% of said exosomes have a longer dimension of about 20-1000 nm, as measured by the NTA (for example, using a Malvern Nanosight NS300). In other embodiments, the exosome populations described in this document comprise a population, where 99% of said exosomes have a longer dimension of about 20-1000 nm, as measured by the NTA (for example, using a Malvern Nanosight NS300). In other embodiments, the exosome populations described in this document comprise a population, in which 90% of said exosomes have a longer dimension of about 40-1000 nm, as measured by the NTA (for example, using a Malvern Nanosight NS300). In other embodiments, the exosome populations described in this document comprise a population, where 95% of said exosomes have a longer dimension of about 40-1000 nm, as measured by the NTA (for example, using a Malvern Nanosight NS300). In other embodiments, the exosome populations described in this document comprise a population, in which 99% of said exosomes have a longer dimension of about 40-1000 nm, as measured by the NTA (for example, using a Malvern Nanosight NS300).
[00194] [00194] The size of the exosome can be measured using the tunable resistive pulse sensor (TRPS). In a specific embodiment, the size of the exosome measured by TRPS is determined using an iZON qNANO Gold. In some embodiments, the exosomes described in this document have a longer dimension of about 20-1000 nm, as measured by TRPS (for example, using an iZON qNano Gold). In other embodiments, the exosomes described in this document have a longer dimension of about 40-1000 nm, as measured by TRPS (for example, an iZON qNano Gold). In other embodiments, the exosome populations described in this document comprise a population, where 90% of said exosomes have a longer dimension of about 20-1000 nm, as measured by TRPS (for example, using an iZON qNano Gold). In other embodiments, the exosome populations described in this document comprise a population, where 95% of said exosomes have a longer dimension of about 20-1000 nm, as measured by TRPS (for example, using an iZON qNano Gold). In other embodiments, the exosome populations described in this document comprise a population, where 99% of said exosomes have a longer dimension of about 20-1000 nm, as measured by TRPS (for example, using an iZON qNano Gold). In other embodiments, the exosome populations described in this document comprise a population, in which 90% of said exosomes have a longer dimension of about 40-1000 nm, as measured by TRPS (for example, using an iZON qNano Gold). In other embodiments, the exosome populations described in this document comprise a population, where 95% of said exosomes have a longer dimension of about 40-1000 nm, as measured by TRPS (for example, using an iZON qNano Gold). In other embodiments, the exosome populations described in this document comprise a population, where 99% of said exosomes have a longer dimension of about 40-1000 nm, as measured by TRPS (for example, using an iZON qNano Gold).
[00195] [00195] The size of the exosome can be measured using electron microscopy.
[00196] [00196] In some embodiments, the methods described in this document comprise the measurement of the charge density of exosomes and / or populations of exosomes included in the purified fractions. In some modalities, charge density is measured by potentiometric titration, anion exchange, cation exchange, isoelectric focus, zeta potential, capillary electrophoresis, capillary zone electrophoresis or gel electrophoresis.
[00197] [00197] In some embodiments, the methods described in this document comprise measuring the protein density of the exosome on the surface of the exosome. The density of the surface can be calculated or displayed as the mass per unit area, the number of proteins per area, number of molecules or intensity of the signal of the molecule per exosome, molar quantity of the protein, etc. Surface density can be measured experimentally by methods known in the art, for example, using bi-layer interferometry (BLI), FACS, Western blotting, fluorescence detection (eg, GFP fusion protein), nano-flow cytometry, ELISA , alphaLISA and / or densitometry by measuring bands in a protein gel.
[00198] [00198] The following examples are presented in order to provide those skilled in the art with full disclosure and description of how to make and use the present invention and are not intended to limit the scope of what the inventors consider their invention nor are they intended to represent that the experiments below are all or the only experiments carried out. Efforts have been made to ensure accuracy with respect to numbers used (eg quantities, temperature, etc.), but some errors and experimental deviations must be considered. Unless otherwise stated, the parts are parts by weight, molecular weight is the average molecular weight, temperature is in degrees Celsius and pressure is atmospheric or close. Standard abbreviations can be used, for example, bp, base pair (s); kb, kilobase (s); pl, picoliter (s); s or sec, second (s); min, minute (s); h or hr, hour (s); aa, amino acid (s); nt, nucleotide (s); and the like.
[00199] [00199] The practice of the present invention will employ, unless otherwise indicated, conventional methods of chemical protein, biochemistry, DNA recombination and pharmacological techniques, within the scope of the technique. Such techniques are fully explained in the literature. See, for example, TE. Creighton, Proteins: Structures and Molecular Properties (W. H. Freeman and Company, 1993); AL.
[00200] [00200] Exosomes were collected from the supernatant of HEK293 SF cell high density suspension cultures after 9 days. The supernatant was filtered and fractionated by anion exchange chromatography and eluted in a gradual gradient of sodium chloride. The peak fraction with the highest concentration of proteins contained exosomes and contaminating cellular components. The peak fraction was isolated and fractionated in an Optiprep ™ density gradient (60% iodixanol w / v) by ultracentrifugation.
[00201] [00201] The exosome fraction was concentrated by ultracentrifugation in a 38.5 mL Ultra-Clear tube (344058) for a SW 32 Ti rotor at
[00202] [00202] The exosome fraction was diluted in ~ 32 mL of PBS in a 38.5 mL Ultra-Clear tube (344058) and ultracentrifuged at 133,900 xg for 3 hours at 4 ° C to sediment the purified exosomes. The sedimented exosomes were then resuspended in a minimum volume of PBS (~ 200 µL) and stored at 4 ° C.
[00203] [00203] To determine specific proteins for exosomes, the Upper and Lower Fractions of the Optiprep ™ gradient were analyzed by liquid chromatography-tandem mass spectrometry. All samples were received in phosphate buffered saline buffer (PBS) or PBS and 5% sucrose. Before analysis, the total protein concentration of each sample was determined by the bicinconinic acid (BCA) assay, after which each sample was adequately diluted to 125 µg / mL in PBS buffer. Then, 50.0 µL of each sample was added to a separate 1.5 mL microcentrifuge tube containing an equal volume of exosome lysis buffer (60 mM Tris, 400 mM GdmCl, 100 mM EDTA, 20 mM TCEP, 1.0% Triton X-100) followed by the transfer of 2.0 µL of 1.0% Triton X-100 solution. All samples were then incubated at 55 ° C for 60 minutes.
[00204] [00204] Protein precipitation was accomplished by adding 1250 µL of ethanol at -20 ° C. To improve efficiency, the samples were vigorously vortexed for approximately 10 minutes and then incubated at -20 ° C for 60 minutes. After incubation, the samples were sonicated in a water bath for 5 minutes. The precipitated material was pelleted by centrifugation for 5 minutes at 15,000 g at 4 ° C. The supernatant was decanted and the sedimented material was completely dried using nitrogen gas. The pellets were resuspended in 30.0 µL of digestion buffer (30 mM Tris, 1.0 M GdmCl, 100 mM EDTA, 50 mM TCEP, pH 8.5), which also reduced disulfide bonds. The free cysteine residues were alkylated by adding 5.0 µL of alkylation solution (375 mM iodoacetamide, 50 mM Tris, pH 8.5) and incubating the resulting solution at room temperature in the dark for at least 30 minutes.
[00205] [00205] After incubation, each sample was diluted using 30.0 µL of 50 mM Tris, pH 8.5, and proteolytic digestion was started by adding 2.0 µg of trypsin. All samples were mixed and then incubated overnight at 37 ° C. After incubation, trypsin activity was stopped by adding 5.0 µL of 10% formic acid. Prior to LC-MS / MS analysis, each sample was desalted using Pierce C18 rotary columns. At the end of this process, each sample was dried and reconstituted in 50.0 µL of water with 0.1% formic acid and transferred to an HPLC flask for analysis.
[00206] [00206] The samples were injected into a UltiMate 3000 RSCLnano low flow chromatography system (Thermo Fisher Scientific) and the triptych peptides were loaded onto an Acclaim PepMap 100 C18 capture column (75 µm x 2 cm, particle size of 3 µm, 100 Å pore size, Thermo Fisher Scientific) using the mobile loading phase (MPL: water, 0.1% formic acid) at a flow rate of 1,000 µL / min. The peptides were eluted and separated with a gradient of mobile phase A (MPA: water, 0.1% formic acid) and mobile phase B (MPB: acetonitrile, 0.1% formic acid) at a flow rate of 300 nL / min via an EASY-Spray C18 analytical column (75 µm x 25 cm, particle size 2 µm, pore size 100 Å, Thermo Fisher Scientific). The gradual gradient used for elution started at 2% MPB, where it was maintained for 8 minutes during loading. The percentage of MPB increased from 2-17% in 35 minutes, again from 17-25% in 45 minutes and, finally, from 25-40% in 10 minutes. The most hydrophobic species were removed, increasing to 98% MPB over 5 minutes, keeping them for 10 minutes. The total time of execution of the method was 135 minutes and allowed enough time for the rebalancing of the column. Washing cycles were performed between non-identical analytical injections to minimize transfer.
[00207] [00207] Mass analyzes were performed with a Q Exactive Basic mass spectrometer (Thermo Fisher Scientific). The mass spectra of precursor ions were measured in a range of 400-1600 Da m / z at a resolution of 70,000. The 10 most intense precursor ions were selected and fragmented in the HCD cell using a collision energy of 27, and the MS / MS spectra were measured in a range of 200-2000 Da m / z at a resolution of 35,000. Ions with charge states of 2-4 were selected for fragmentation and the dynamic exclusion time was set to 30 seconds. An exclusion list containing 14 common polysiloxanes was used to minimize the misidentification of known contaminants.
[00208] [00208] Proteins were first identified and quantified (without markings) using Proteome Discoverer software (version
[00209] [00209] In Target Decoy PSM Validator, the maximum delta Cn and the strict and relaxed false discovery rates (FDRs) were set to 1 because the data was searched again using the Scaffold software (version 4.8.2, Proteome Software Inc.) . In Scaffold, the data was also searched using the X! Tandem open source algorithm to identify proteins using a 99.0% protein limit, a minimum of 2 peptides and a 95% peptide limit.
[00210] [00210] To determine the identity of new exosome-specific proteins, the total peptide spectrum matches (PSMs) were compared for proteins found in the upper exosomal fraction of the Optiprep ™ gradient compared to those in the lower fraction. As shown in Figure 2, there was a weak correlation between the upper fraction proteins (Y axis) and the lower fraction proteins (X axis). The proteins plotted above the dotted line represent proteins enriched with exosomes, while those below the dotted line represent proteins enriched with contaminants. Importantly, several membrane-associated proteins have been identified that have been highly enriched in the exosomal fraction, including (1) negative prostaglandin F2 regulator (PTGFRN), (2) basigine (BSG), (3) member of the immunoglobulin superfamily 3 (IGSF3), (4) member of the immunoglobulin 8 (IGSF8) superfamily, (5) beta-1 integrin (ITGB1), (6) alpha-4 integrin (ITGA4), (7) cell surface antigen heavy chain 4F2 (SLC3A2), and (8) a class of ATP carrier proteins (ATP1A1, ATP1A2, ATP1A3, ATP1A4, ATP1B3, ATP2B1, ATP2B2, ATP2B3, ATP2B4). As shown in the triptych peptide coverage maps in Figures 3- 5, the mass spectrometry study resulted in extensive coverage of PTGFRN (Figure 3), IGSF8 (Figure 4) and Basigine (Figure 5). Together, these results demonstrate that there are numerous transmembrane proteins enriched in populations of purified exosomes that can be useful for purifying exosomes from heterogeneous populations or for use as scaffold structures in the generation of manipulated exosomes.
[00211] [00211] To confirm that the specific proteins of exosomes identified in the mass spectrometry studies were highly enriched on the surface of the exosomes, protein transfer was performed in the total cell lysate and in the purified exosomes populations of HEK293 cells. As shown in Figure 6A, the total protein pattern differed substantially between the total cell lysate (on the left) and the exosomal lysate (on the right). Specifically, there was a strong ~ 110kDa band in the exosomal lysate that was absent in the total cell lysate. Western blotting for PTGFRN revealed a band of the expected size of ~ 110kDa in the exosomal lysate, but not in the cell lysate (Figure 6B), indicating that PTGFRN is highly enriched in exosomes and can be visually detectable in the total exosomal lysate.
[00212] [00212] Mass spectrometry studies have indicated the presence of several new membrane proteins associated with exosomes. To further confirm this association, the exosome fractions were purified on self-forming Optiprep ™ gradients and analyzed by Western blotting. As shown in Figure 7A, the total protein is detected in all fractions of the gradient and the exosome marker proteins Alix and Syntenin are enriched in fractions 2-6. It is important to note that each of the new surface marker proteins analyzed was enriched in these same fractions, indicating a strong and specific association with exosomes (Figure 7B). The demonstration that these transmembrane proteins are highly expressed and enriched in exosomes provides an opportunity for purification of exosomes, using a binding agent directed against any of these proteins, in addition to generating modified exosomes on the high-expression surface containing heterologous proteins fused to any of these new proteins (Figure 8).
[00213] [00213] PTGFRN, BSG, IGSF3 and IGSF8 are all type I single-pass transmembrane proteins with an N terminal facing the extracellular / extravesicular environment and a C terminal located in the lumen of the cytoplasm / exosome and contain at least two immunoglobulins V ( IgV) repeats, as shown in Figure 8. PTGFRN was the most highly enriched surface protein detected in the mass spectrometry analysis shown in Figure
[00214] [00214] Full-length PTGFRN and several truncated PTGFRN mutants were then stably expressed with an N-terminal FLAG marker on HEK293 cells (Figure 11A). Exosomes from cell culture were collected and analyzed by Western blotting with an anti-FLAG antibody. The result is provided in Figure 11B. In contrast to fusion proteins containing GFP at its C-terminus (Figures 9 and 10), fusion proteins that contain an N-terminal FLAG marker did not produce a low molecular weight band (marked "product without cleavage" in Figure 11B) and the shortest truncations were detected at a low level. This result suggests that the cleavage event probably removes the N-terminus of the protein bound to the FLAG epitope used for Western blotting (Figure 11B).
[00215] [00215] PTGFRN is little detected in the cell lysate and a mixture of intact and cleaved PTGFRN is detected in the purified exosomes, as suggested by the result of the Western blot test provided in Figures 6A and B.
[00216] [00216] PTGFRN can be used as an attractive fusion partner for decorating / loading high-density exosomes, but due to its size (~ 100kDa), a smaller truncated version would be preferred to allow the co-expression of large biologically molecules active. The ADAM10-dependent cleavage detected in each of the IgV truncation mutants presents a problem for high density loading because a certain percentage of any fusion protein would be cleaved from the exosomal surface, reducing the degree of loading / display. To identify a minimal fragment of PTGFRN that facilitates the display of the high density exosomal surface without undergoing protease cleavage, PTGFRN without five of the six IgV domains (PTGFRN_IgV6) was expressed as a fusion to a FLAG marker and a fusion partner protein (Figure 13). Expression of fusion proteins containing PTGFRN_IgV6 produced the predicted cleavage product identified earlier (Figure 14B, # 451). PTGFRN_IgV6 serial truncation mutants without four additional amino acids at a time were also tested and the removal of 12 amino acids produced exosomes that did not undergo PTGFRN cleavage (Figure 14A, Figure 14B, # 454). PTGFRN # 454 is a polypeptide of SEQ ID NO: 33. In addition, since the FLAG marker is N-terminal to the cleavage site, shorter truncations of PTGFRN_IgV6 resulted in greater expression of the fusion protein, suggesting that cleavage is not occurring with these truncations.
[00217] [00217] The results provided in Figure 15 further suggest that complete PTGFRN (FL) and PTGFRN_454 (sIgV) would be ideal fusion partners for the high-density expression of luminal proteins (C-terminal fusions) or surface proteins (N-terminals) over and / or within exosomes. To test this hypothesis, several scaffold structure proteins were tested for their ability to produce high-density display exosomes. Fusion proteins comprising a scaffold structure protein and GFP have been expressed in cell culture, specifically fusion proteins containing GFP fused to the luminal side of the frequently used pDisplay scaffold structure (PDGF receptor), PalmPalm (palmitoylation sequence), CD81 or full length PTGFRN (FL) or PTGFRN_454 (sIgV). Dose titration of purified exosomes from cells that stably express each fusion protein demonstrated that PTGFRN fusion proteins resulted in a much greater GFP fluorescence than any other scaffold structure, including the well-known exosomal protein CD81. Compared to the pDisplay scaffolding structure, the full-length PTGFRN and sIgV resulted in a> 25-fold increase in loading efficiency (Figure 15). These results suggest that the use of full-length PTGFRN or truncated PTGFRN (sIgV) that is short enough to remove the cleavage site, as a fusion partner allows for the display or loading of high-density exosomes.
[00218] [00218] The level of expression of PTGFRN suggests that it would be an ideal fusion partner for the production of manipulated exosomes. To determine whether other members of the immunoglobulin-containing protein family would be suitable for exosome engineering, HEK293 cells were stably transfected with an IGFS8-GFP fusion protein and the resulting exosomes were purified (Figure 16A). Native exosomes and IGSF8-GFP exosomes were analyzed on a SDS-PAGE mini-PROTEAN® TGX stain-free gel (Bio-Rad, Inc.), which uses a tryptophan binding dye to detect proteins, as provided in Figure 16B. IGSF8 contains 10 tryptophan residues, allowing easy detection. Western blotting using an anti-GFP antibody confirmed the expression of IGSF8-GFP in overexpressing exosomes (Figure 16B, bottom). Interestingly, when IGSF8-GFP exosomes were tested for GFP fluorescence compared to GFP fusions to the scaffold structure pDisplay (PDGF receptor), CD81 or PTGFRN (FL) or PTGFRN_454 (sIgV), IGSF8 (FL IGSF8) failed to present enrichment of GFP in a low level stochastic display observed with pDisplay (Figure 17). This result suggests that not all members of the IgV family can be used as a fusion protein to project the surface display of the high density / luminal charge exosome, and that PTGFRN and other family members are superior to IGSF8 in this regard . IGSF8 expression, however, was detected at high levels on the surface of unmodified exosomes, which would allow IGSF8 to be used as a target for exosome affinity purification.
[00219] [00219] The extracellular domain (ECD) of PTGFRN is 98kDa and contains six tandem IgV replications. PTGFRN ECD may be a desirable target for exosome affinity purification reagents due to its size and high levels of expression. To characterize this PTGFRN segment, PTGFRN ECD was expressed as a fusion protein with the endogenous signal peptide at the N (SP) terminal and a PAR1 cleavage site and Fc domain at the C terminal (Figure 18). PAR1 is a substrate for thrombin and can be used to elute Fc fusion proteins using Protein A resin. PTGFRN has nine predicted N-linked glycosylation sites and 6 predicted disulfide bonds that prevent the use of bacterial expression for the production of endogenous glycoproteins. The PTGFRN ECD was overexpressed using the Expi293 Expression System (Thermo Fisher Scientific), which is used to produce recombinant proteins from high-yielding mammals. The conditioned cell culture medium of the transfected Expi293 cells was filtered and purified with 0.2 µm in Protein A, followed by elution of low pH glycine and immediate neutralization. The Fc marker was removed with thrombin treatment and the set of cleaved proteins was subjected to a new run with protein A. The flow was collected, concentrated and polished in preparative SEC. The purified PTGFRN ECD was analyzed by gel filtration chromatography in PBS pH 7.4 using a Superdex 200 column (GE Healthcare) and detected at 280 nm UV fluorescence. Figure 19A shows a single elution peak at ~ 55mL and Figure 19B shows a single protein product at the predicted size of PTGFRN ECD when the eluate peak was analyzed on a SDS-PAGE mini-PROTEAN® TGX stain-free gel ( Bio-Rad, Inc.), indicating that PTGFRN ECD can be purified from mammalian cells.
[00220] [00220] To confirm the appropriate expression of the PTGFRN ECD, the purified protein was analyzed by size-exclusion chromatography / light scattering from various angles (SEC-MALS), using BSA and an anti-VLA4 antibody as a comparison standard. The recombinant PTGFRN ECD was eluted to ~ 2x its predicted molecular weight
[00221] [00221] PTGFRN is poorly characterized in the literature and its role as an exosomal protein is largely unexplored. PTGFRN is also known as CD9 Partner 1 (CD9P-1) due to its interaction with CD9, which is also found on the surface of exosomes. To better understand which proteins PTGFRN binds to, the monobiotinylated recombinant PTGFRN ECD was generated and probed in a protein microarray containing more than 20,000 proteins that comprise 81% of the human proteome (CDI Laboratories). The binding analysis was performed at pH 5.6 and 7.4 to represent the pH of the acidifying endosome and the cytosol, respectively. Nine positive occurrences were identified at pH 7.4 and 16 at pH 5.6. Three proteins (LGALS1, galectin-1; FCN1, ficolin-1; MGAT4B, alpha-1,3-mannosyl-glycoprotein 4-beta-N-acetylglucosaminyltransferase B) were identified at pH 5.6 and pH 7.4 (Figure 21 ). LGALS1 is known to bind to monomeric carbohydrates and complex glycans, but has not been implicated as a PTGFRN binding partner. To confirm the interaction between PTGFRN and LGALS1, the biotinylated recombinant PTGFRN ECD was connected to a streptavidin optical probe and analyzed by biological layer interferometry (BLI) using an Octet® RED96 (Pall). The dose-dependent binding of galectin-1 to PTGFRN was confirmed by BLI (Figure 22). The interaction between LGALS1 and PTGFRN was reversible and competed for lactose in a dose-dependent manner (Figure 23), demonstrating the specificity of this interaction. These results also suggest that exosomes can be purified using PTGFRN binding partners as affinity reagents.
[00222] [00222] Biotinylated PTGFRN was attached to an Octet® RED96 streptavidin probe (Pall) and incubated in PBS + 0.1% Tween 20 with increasing concentrations of a mouse monoclonal antibody against CD315, another name for PTGFRN ( MABT883, Millipore Sigma). Dose-dependent binding was detected, suggesting specific recognition of PTGFRN by the antibody (Figure 24). To determine whether the anti-CD315 antibody could bind to exosomes, the anti-CD315 antibody was attached to a protein L probe and incubated with increasing amounts of purified HEK293 Optiprep ™ exosomes (Figure 25). As shown in Figure 25, the dose-dependent deflection after incubation with purified exosomes shows that the anti-CD315 antibody can recognize endogenous PTGFRN on the surface of the exosome. A similar experiment was performed with HEK293 cells transfected stably with full-length PTGFRN to generate overexpressing exosomes of PTGFRN (exosomes PTGFRN ++). Overexpressing exosomes were incubated with immobilized anti-CD315 antibody and resulted in a dose-dependent deflection indicating specific binding between the antibody and the exosomes (Figure
[00223] [00223] The results in Examples 6 and 7 suggest that exosomes can be purified based on affinity interactions with PTGFRN. Full-length PTGFRN and a series of truncation mutants were expressed as monobiotinylated recombinant proteins using the Expi293 system described above (Figure 28, left). Each of the truncations was incubated with the anti-CD315 antibody and the binding was measured by BLI. Only full-length PTGFRN bound to the anti-CD315 antibody, indicating that the epitope is at the N-terminus of the protein in the first IgV domain.
[00224] [00224] Polyclonal antibody sets were generated by injecting rabbits with recombinant PTGFRN ectodomain of similar length to construction 1 in Figure 28, but without a biotinylation sequence. The sets of polyclonal antibodies were purified from terminal bleeding by protein A and tested for reactivity against PTGFRN truncation fragments. Each of the fragments was analyzed on a spotless SDS-PAGE mini-PROTEAN® TGX denaturing gel (Bio-Rad, Inc.) confirming the expression of proteins of correct length (Figure 29A). Western blotting was then performed on the samples using the collected rabbit polyclonal antibodies, and bands of correct size were detected in each lane, as well as for native control exosomes, confirming specific reactivity with PTGFRN polyclonal antibodies (Figure 29B). To confirm this result, each of the biotinylated PTGFRN fragments was analyzed by BLI and the results are provided in Figure 30. Incubation with the sets of polyclonal antibodies was linked in all conditions, demonstrating broad reactivity with the antibodies for each of the IgG domains of PTGFRN.
[00225] [00225] Cell lines of different tissues of origin (HEK293SF, kidney; HT1080, connective tissue; K562, bone marrow; MDA-MB-231, breast; Raji, lymphoblasts) were cultured to the log phase and transferred to media supplemented with serum depletion of exosomes for ~ 6 days. Bone marrow-derived mesenchymal stem cells (MSC) were cultured in 3D microcarriers for five days and supplemented in serum-free medium for three days. The supernatant was isolated and the exosomes were purified using the Optiprep ™ density gradient ultracentrifugation method described above. Each of the purified exosomes was analyzed by LC-MS / MS, as described above, the number of peptide spectrum matches (PSMs) for various exosome surface proteins was quantified (PTGFRN, IGSF8, IGSF3, BSG, SLC3A2, ITGB1, CD81 and CD9) and the results are provided in Figure 31. CD81 and CD9 tetraspanins were detectable in most populations of purified exosomes, but were, in some cases, equal to or less than other surface markers (for example, compare CD9 to PTGFRN, BSG and SLC3A2 on all cell lines). This discovery indicates that the newly identified surface markers, including members of the IgV protein family, are suitable targets for the development of exosome affinity purification methods for various unrelated cell lines derived from different tissues.
[00226] [00226] To generate knockout cells for PTGFRN, HEK293SF cells were transfected with recombinant Cas9 and guide RNAs directed to exon 2 and the transmembrane region of PTGFRN. Guide RNAs targeting the exon2 generated by ThermoFisher include: (1) CGTTGGCAGTCCGCCTTAAC, CRISPR926045_CR (SEQ ID NO: 36); (2) CATAGTCACTGACGTTGCAG, CRISPR926054_CR (SEQ ID NO: 37); (3) TTGTGGAGCTTGCAAGCACC, CRISPR926055_CR (SEQ ID NO: 38); and (4) GTTCTTTATGTGGAGCTCCA, CRISPR926071_CR (SEQ ID NO: 39). Guide RNAs targeting the transmembrane region generated by ThermoFisher included (1) TATCCCTTGCTGATCGGCGT, TMgRNA5.1.97 (SEQ ID NO: 40); (2) GCTGCAGTACCCGATGAGAC, TMgRNA3.7.87 (SEQ ID NO: 41).
[00227] [00227] The editing and deletion of targeted genes from exon 2 and the transmembrane region of PTGFRN were confirmed by PCR and sequencing. Exosomes from five clonal PTGFRN knockout cell lines (PTGFRN KO) were purified as described above and analyzed by PAGE and Western blotting using the rabbit polyclonal antibody sets described in Example 8. As shown in Figure 32B, the bands corresponding to PTGFRN were not detected in any of the five knockout clones, demonstrating the targeted deletion of PTGFRN in purified producer cells and exosomes. It is important to note that the exosomal production yield and the general patterns of protein bands (Figure 32A) were not affected by the PTGFRN deletion,
[00228] [00228] To determine whether the PTGFRN deletion changed the proteomic profile of purified exosomes, native exosomes and KO exosomes to PTGFRN were analyzed by comparative mass spectrometry. As shown in Figure 33, the protein content of native exosomes and KO for PTGFRN was very similar, with the only exception of PTGFRN, which was undetectable in KO exosomes for PTGFRN. The exosome markers Alix, CD81, TSG101 and CD9 were not significantly different between groups. These data demonstrate that PTGFRN can be removed from exosomes without changing the proteomic profile of exosomes.
[00229] [00229] To verify whether the PTGFRN deletion resulted in complete functional removal of PTGFRN and to demonstrate that the anti-PTGFRN antibody (anti-CD315) described in Example 7 is specific for PTGFRN, exosome binding experiments were performed using BLI with native exosomes, PTGFRN overexpressing exosomes (PTGFRN ++) and KO exosomes for PTGFRN. Similar to the experimental results described in Figure 27 and Example 7, PTGFRN ++ exosomes bind to the immobilized anti-CD315 antibody with a greater affinity than native exosomes (Figure 34). On the other hand, an equal number of KO exosomes for PTGFRN failed to bind to the immobilized antibody (Figure 34), demonstrating that the deletion of PTGFRN eliminates the interaction of KO exosomes for PTGFRN with anti-PTGFRN affinity reagents.
[00230] [00230] Personalized monoclonal antibodies against PTGFRN were generated from immunized rabbits, as described in
[00231] [00231] The experimental data provided in Figures 11, 13, 14 and 15 demonstrate that several proteins can be drastically overexpressed using PTGFRN as an overexpression scaffold structure. Overexpression using PTGFRN was significantly better than expression using other structures in exosome overexpression scaffolding. To determine the range of proteins that can be successfully overexpressed when fused with PTGFRN, several manipulated exosomes were generated. Factor VIII (FVIII) is a large enzyme involved in the coagulation cascade. A fragment of FVIII without the B domain (BDDFVIII) was fused to the N-terminus (outer side) of PTGFRN and expressed in HEK293SF cells. The purified exosomes were analyzed by PAGE (Figure 36A) and Western blot test (Figure 36B). A FVIII light chain generated by processing a complete FVIII in cell culture was readily detected in the manipulated exosomes, but not in the native exosomes using antibodies against FVIII (FIGURE 36B; catalog # GMA-8025, Green Mountain Antibodies). A complete FVIII has a molecular weight of 165kDa, which is significantly greater than the molecular weight of PTGFRN (~ 120kDa), demonstrating that very large proteins, including enzymes, can be successfully expressed as PTGFRN fusions on the surface of the exosomes.
[00232] [00232] The PTGFRN fusion partners described above are all proteins with an ordered three-dimensional structure. XTEN® peptides (Amunix; Mountain View, CA) have long, disordered and repeated sequences with a dramatically increased apparent molecular mass compared to the primary sequence. A fusion construct encoding XTEN (a protein comprising 288 randomized amino acids that include 8% Ala, 12% Glu, 18% Gly, 17% Pro, 28% Ser and 17% Thr), a fragment of PTGFRN (SEQ ID NO: 33) and GFP was stably expressed in HEK293SF cells. The purified exosomes were isolated and analyzed by PAGE (Figure 37A) and Western blotting (Figure 37B). As shown in Figure 37B, the C-terminal GFP of the fusion protein was detected by Western blotting, demonstrating structure translation of the fusion protein into the purified exosomes. These results demonstrate that unstructured proteins can also be expressed in a stable way as fusions to PTGFRN. In addition, these results show that heterologous proteins can be fused simultaneously to the N and C terminals of PTGFRN and result in intact proteins displayed on the exosome surface and in the lumen, respectively. Thus, PTGFRN is a robust scaffold structure that is capable of fusions of proteins that vary in size, from several amino acids (for example, a FLAG marker) to more than 150kDa (BDDFVIII) of several structures and classes in one or both. N or C terminals.
[00233] [00233] The data in Example 3 and Figure 15 demonstrate that PTGFRN is superior to other exosome supports in the expression of heterologous proteins in a larger population of exosomes. These results cannot, however, differentiate between increased expression in a subset of exosomes versus uniformly increased expression in all exosomes in a purified population. In order to develop a uniform therapy for exosomes, it is preferable to have a population of homogeneous exosomes with uniformly increased expression, rather than a population of heterogeneous exosomes, including overexpressing exosomes and unmodified exosomes. To solve this problem, we characterized individual exosomes in populations of exosomes, particle by particle, by nano-flow cytometry, using Flow NanoAnalyzer (NanoFCM, Inc .; Xiamen, China). Flow NanoAnalyzer can measure light scattering and fluorescence emission from individual nanoparticles up to 10 nm in diameter. Native exosomes and modified exosomes encoding GFP luminous fusions for CD9, CD81 or PTGFRN have been isolated from cells
[00234] [00234] The N-terminus of PTGFRN consists of a predicted signal peptide sequence (amino acids 1-21; SEQ ID NO: 8). To determine whether this sequence can improve expression of a transgene in purified exosomes, the signal peptide PTGFRN was compared with a signal peptide from a heterologous protein, DsbA11. HEK293SF cells were stably transfected with expression constructs encoding (i) full-length wild type PTGFRN fused to GFP; (ii) a small fragment of PTGFRN (454-PTGFRN; SEQ ID NO: 33) containing the endogenous signal peptide of PTGFRN fused to GFP; or (iii) a small fragment of PTGFRN (454-PTGFRN; SEQ ID NO: 33) with the endogenous signal peptide of PTGFRN replaced by a signal peptide from the bacterial gene DsbA11 (Koerber et al., Journal of molecular biology, 427.2 (2015 ): 576-586), fused to GFP. As shown in
[00235] [00235] The experimental data described above demonstrate that PTGFRN is a robust scaffold structure, capable of overexpression of many classes of proteins. Antibodies and antibody fragments that bind to antigens are an important class of therapeutic peptides with diverse applications in the treatment of many diseases. To determine whether a functional antigen-binding fragment could be expressed in exosomes using PTGFRN as a scaffold structure, HEK29SF cells were stably transfected to overexpress a fusion protein consisting of a single Fab chain that recognizes the CLEC9A lectin (clone 10B4, Millipore Sigma, catalog # 04-148; and as described in Caminschi et al., Blood, 112: 8 (2008)), PTGFRN, GFP and complete FLAG marker (Figure 40A). The purified Optiprep ™ exosomes were run on a spotless protein gel and transferred with an antibody against the FLAG marker, showing significant overexpression of the full-length fusion protein (Figure 40B).
[00236] [00236] The purified anti-CLEC9A exosomes were tested by BLI for binding to immobilized CLEC9A-Fc (R&D Systems, catalog
[00237] [00237] Therapeutic exosomes of various types of cells have been used for clinical and research purposes. Stem cells of various varieties, including neural precursor stem cells and mesenchymal stem cells, have been shown to have therapeutic benefit, but most studies using these cells are based on unmodified natural exosomes. It would be desirable, therefore, to design these cell lines to overexpress specific ligands or other target proteins. The bone marrow-derived mesenchymal stem cells were cultured in a 3D bioreactor system based on a 1.1 L microtransporter. After five days of cell expansion, the culture medium was discarded and the cells were cultured for another three days in medium. without serum. The serum-free medium was filtered through a 100 µm filter to remove microcarriers and centrifuged at low speed to remove cell debris and contaminants. The clarified medium was then purified by Optiprep ™ density gradient ultracentrifugation as described in Example 1. The purified exosomes from HEK293SF cells and MSCs were analyzed by Western blotting for PTGFRN and the established exosomal proteins ALIX, TSG101, CD63, CD9 and CD81. As shown in Figure 42, all of these proteins were expressed in HEK293SF cells and MSCs, suggesting that exosomal proteins, for example, PTGFRN, can be used as a scaffold structure to generate surface-modified MSC exosomes.
[00238] [00238] The results in Examples 9 and 15 demonstrate that numerous cells derived from humans naturally express PTGFRN and the other new exosomal proteins identified in Example 1. To determine whether PTGFRN can be used as a universal exosomal scaffold structure protein, Chinese hamster ovary (CHO) cells were stably transfected with a plasmid expressing full-length PTGFRN fused to a FLAG marker ("the PTGFRN-FLAG plasmid"). Exosomes were purified from HEK293SF wild-type cells, HEK293SF cells transfected with the PTGFRN-FLAG plasmid, CHO cells and CHO cells transfected with the PTGFRN-FLAG plasmid using the method described in Example 1. As shown in Figures 43A-C , PTGFRN-FLAG was successfully overexpressed in HEK293SF cells and CHO cells, as detected by spotless PAGE (Figure 43A) and Western blotting with antibodies against PTGFRN (Figure 43B) and FLAG (Figure 43C). This result demonstrates that non-human cells (eg CHO cells) and human cells (eg HEK cells) can produce exosomes that overexpress human PTGFRN. This result indicates that PTGFRN is a universal scaffold structure protein to generate manipulated exosomes from many different cell types and species.
[00239] [00239] Previous examples have demonstrated that overexpression of PTGFRN results in exosomes with a higher number of proteins and / or activity compared to conventional exosomal proteins (for example, Example 13; Figure 15). As PTGFRN is a transmembrane protein and has its N-terminal on the extravesicular surface and its C-terminal on the exosomal lumen, PTGFRN can be a scaffold structure protein suitable for loading the lumen of exosomes with charge proteins. To investigate this possibility, HEK293SF cells were engineered to stably express a bipartite reporter system that uses the small molecule rapamycin to facilitate protein-protein interactions. CD9 (Figure 44A) or PTGFRN (Figure 44B) were fused to GFP, a FLAG marker and FKBP. The cells were also engineered to stably express mCherry fused to a V5 and FRB marker. In the presence of the small molecule Rapamycin, the FRB and FKBP proteins dimerize to form a stable complex. Therefore, culturing cells in the presence of Rapamycin may allow the association between the mCherry loading protein and CD9 or PTGFRN during exosomal biogenesis. Exosomes purified from these cells will be washed to remove Rapamycin, allowing the release of mCherry as a soluble charge in the exosomal lumen. (Figures 44A-B).
[00240] [00240] CD9 loading reporter cells were cultured in the presence of Rapamycin for 0, 1 or 2 days. The PTGFRN loading reporter cells were cultured in the presence of Rapamycin for 5 days. Exosomes were purified from cell cultures in the absence of Rapamycin, allowing the release of charge in the exosomal lumen. The purified exosome samples were run on a denaturing polyacrylamide gel and analyzed for the presence of total protein and Western blotting against the scaffold structure protein (anti-FLAG) or the mCherry load (anti-V5). PTGFRN samples were loaded onto the polyacrylamide gel with much less material compared to CD9 samples, but PTGFRN was easily detectable by FLAG Western blotting. The mCherry load was also detected at a level comparable between the PTGFRN and CD9 scaffold structure samples (Figure 45A). When the scaffold structure and load protein bands were measured by densitometry and normalized to the amount of exosomes collected, the scaffold structure of PTGFRN was expressed at a higher level and was able to carry much more mCherry load contained in the proteins of structure in CD9 scaffolding (Figure 45B). These data indicate that PTGFRN can be expressed as a fusion protein with a luminal loading peptide to a greater extent than the conventional exosomal protein CD9, and that the use of PTGFRN results in a higher directed charge load compared to the exosomal protein conventional. These data indicate that complex multi-part engineering systems can be used in the context of a PTGFRN scaffolding structure and result in robust loading of the load into the exosome lumen.
[00241] [00241] A polynucleotide that encodes a modified exosomal protein is generated using a polynucleotide that encodes an entire exosomal protein or a truncated exosomal protein. A specific truncated exosome protein is selected by screening various truncated exosomal proteins and selecting a truncated protein with optimal capabilities to be incorporated into the exosomal membranes and interact with a binding agent. The targeting of the truncated proteins to the membranes of the exosome is tested by nano-flow cytometry.
[00242] [00242] A polynucleotide that encodes a modified exosomal protein is generated by adding a polynucleotide that encodes an affinity marker (glutathione-S-transferase, S-peptide, FLAG tag, GFP, etc.) to the polynucleotide that encodes an entire exosomal protein or truncated (for example, PTGFRN, BSG, IGSF8, ITGB1, ITGA4, SLC3A2 and ATP carrier). The modified polynucleotide expresses a fusion protein. The polynucleotide is further modified to improve its targeting to the membranes of the exosome and / or its affinity for a binding agent.
[00243] [00243] A different type of polynucleotide that encodes a modified exosomal protein is generated by the addition of a polynucleotide that encodes a therapeutic peptide (for example, an antibody, an enzyme, a linker, a receptor, an antimicrobial peptide, a variant or a fragment thereof) to the polynucleotide encoding a whole or truncated exosomal protein (for example, PTGFRN, BSG, IGSF8, ITGB1, ITGA4, SLC3A2 and ATP transporter). The modified polynucleotide expresses a fusion protein presented on the surface of an exosome. The fusion protein maintains the therapeutic activity of the therapeutic peptide.
[00244] [00244] A different type of polynucleotide that encodes a modified exosomal protein is generated by adding a polynucleotide that encodes a targeting fraction (e.g., a targeting fraction specific to a specific organ, tissue, or cell) to the polynucleotide that encodes a whole or truncated exosomal protein (for example, PTGFRN, BSG, IGSF8, ITGB1, ITGA4, SLC3A2 and ATP transporter). The modified polynucleotide expresses a fusion protein presented on the surface of an exosome. The fusion protein allows the exosome to target a specific organ, tissue or cell.
[00245] [00245] The location of modified exosomal proteins on the surface of the exosome is also tested by nano flow cytometry.
[00246] [00246] A producer cell that generates exosomes with a modified surface is produced by introducing an exogenous sequence that encodes an exosomal protein or a variant or fragment of the exosomal protein. A plasmid encoding an exosomal protein is transiently transfected to induce high-level expression of the exosomal protein on the surface of the exosome. A plasmid encoding a modified exosomal protein is transiently transfected to produce exosomes having the modified exosomal protein on the surface.
[00247] [00247] A polynucleotide that encodes an exosomal protein, a variant or fragment of an exosomal protein, or an exogenous sequence that encodes an affinity marker, a therapeutic peptide or a targeting fraction is stably transformed into a producing cell for produce surface-modified exosomes. The exogenous sequence that encodes an affinity marker, a therapeutic peptide or a targeting fraction is inserted into a genomic site that encodes an exosomal protein to generate a fusion protein comprising the affinity marker attached to the exosomal protein. A polynucleotide that encodes a modified exosomal protein is integrated into a genomic site that encodes an exosomal protein.
[00248] [00248] A producing cell line is generated by the stable transfection of at least two polynucleotides, each encoding an exosomal protein, a variant or a fragment of an exosomal protein or an exogenous peptide (e.g., affinity marker, targeting fraction, therapeutic peptide). A different producing cell line is also generated by inserting two or more exogenous sequences (for example, exogenous sequences that encode an affinity marker, a marker, a targeting peptide, a therapeutic peptide, etc.) at various genomic sites, within or in the vicinity of the genomic sequence encoding an exosomal protein, to generate a surface-modified exosome comprising multiple modified exosomal proteins. Each of the plurality of modified exosomal proteins is directed to the surface of the exosomes. Exosomes have affinities with two different binding agents and are purified by one or both binding agents.
[00249] [00249] Binding agents for exosome affinity purification are developed by biopanning / directed evolution that elute under mild conditions.
[00250] [00250] The binding agent is connected to a solid support (for example, a porous agarose sphere) and forms a conventional chromatography system (for example, GE AKTA). A sample containing exosomes is applied to the column for affinity purification
[00251] [00251] All publications, patents, patent applications and / or other documents cited in this document are incorporated by reference in their entirety for all purposes, to the same extent as if each individual publication, patent, patent application and / or another document was individually indicated to be incorporated as a reference for all purposes.
[00252] [00252] The present disclosure provides, inter alia, cannabinoid compositions and related compositions.
The present disclosure also provides a method of treating neurodegenerative diseases by administering cannabinoid and related compositions.
Although several specific modalities have been illustrated and described, the above specification is not restrictive.
It will be realized that several changes can be made without departing from the spirit and scope of the invention (s). Many variations of the invention will become apparent to those skilled in the art upon review of this specification

权利要求:
Claims (77)
[1]
1. Method for isolating an exosome, characterized by the fact that it comprises the steps of: providing a sample comprising the exosome; placing the sample in contact with a binding agent with affinity for a target protein, wherein the target protein comprises PTGFRN, BSG, IGSF2, IGSF3, IGSF8, ITGB1, ITGA4, SLC3A2, ATP transporter or a fragment or variant thereof ; and isolating the exosome based on a link between the target protein and the binding agent.
[2]
2. Method according to claim 1, characterized by the fact that said sample is obtained from a cell cultured in vitro, optionally in which the cell is a HEK293 cell.
[3]
3. Method, according to claim 1, characterized by the fact that said sample is obtained from a subject's body fluid.
[4]
4. Method according to claim 2, characterized by the fact that the cell is genetically modified to express the target protein.
[5]
Method according to claim 2 or 4, characterized in that the cell comprises an expression plasmid encoding the target protein.
[6]
6. Method according to claim 4, characterized by the fact that the cell is genetically modified to comprise an exogenous sequence that expresses a marker with affinity for the binding agent, in which the exogenous sequence is inserted into a genome of the cell.
[7]
7. Method according to claim 6, characterized by the fact that the exogenous sequence is inserted into a genomic site located at the 3 'or 5' end of an endogenous sequence that encodes PTGFRN, BSG, IGSF2, IGSF3, ITGB1, ITGA4 , SLC3A2 or ATP transporter.
[8]
8. Method, according to claim 6, characterized by the fact that the exogenous sequence is inserted into a genomic site located within an endogenous sequence encoding PTGFRN, BSG, IGSF2, IGSF3, ITGB1, ITGA4, SLC3A2 or ATP transporter .
[9]
Method according to any one of claims 7 to 8, characterized in that the target protein is a fusion protein comprising the marker, and PTGFRN, BSG, IGSF3, IGSF2, ITGB1, ITGA4, SLC3A2, ATP transporter or a fragment or variant thereof.
[10]
10. Method according to any one of claims 1 to 9, characterized in that the cell is genetically modified to have reduced expression of ADAM10.
[11]
11. Method according to any one of claims 1 to 10, characterized in that the exosome comprises the target protein.
[12]
12. Method according to any of claims 1 to 11, characterized in that the target protein is selected from PTGFRN, BSG, IGSF3, ITGB1, ITGA4, SLC3A2 and ATP transporter.
[13]
13. Method according to any one of claims 1 to 11, characterized in that the target protein comprises a fragment or variant of PTGFRN, BSG, IGSF3, IGSF2, ITGB1, ITGA4, SLC3A2 or ATP transporter.
[14]
14. Method according to claim 13, characterized in that the target protein comprises a polypeptide of SEQ ID NO: 33.
[15]
Method according to any one of claims 13 to 14, characterized in that the target protein is a fusion protein comprising PTGFRN, BSG, IGSF3, IGSF2, ITGB1, ITGA4, SLC3A2, ATP transporter or a fragment or a variant thereof, and an affinity marker, wherein the affinity marker has affinity for the binding agent.
[16]
16. Method according to claim 15, characterized in that the binding agent comprises an immunoglobulin, a protein, a peptide or a small molecule.
[17]
17. Method according to any one of claims 1 to 16, characterized in that the binding agent is attached to a solid support, optionally wherein the solid support comprises a porous agarose sphere, a microtiter plate, a magnetic sphere or a membrane.
[18]
18. Method according to claim 17, characterized by the fact that the solid support forms a chromatography column.
[19]
19. Method, according to claim 18, characterized by the fact that the step of contacting the sample with the binding agent is carried out by applying the sample to the chromatography column.
[20]
20. Method according to any one of claims 1 to 19, characterized in that it further comprises the steps of: bringing a subset of the sample into contact with a different binding agent with affinity for a different target protein; and isolating the exosome based on a link between the different target protein and the different binding agent.
[21]
21. Method according to any one of claims 1 to 20, characterized in that the different target protein comprises PTGFRN, BSG, IGSF3, IGSF2, ATP transporter or a fragment or variant thereof.
[22]
22. Method according to any one of claims 1 to 21, characterized in that the different target protein comprises PTGFRN or a fragment or variant thereof.
[23]
23. The method of claim 22, characterized in that the different target protein comprises a polypeptide of SEQ ID NO: 33.
[24]
24. Exosome characterized by the fact that it is produced by the method as defined in any one of claims 1 to 23.
[25]
25. Pharmaceutical composition characterized by the fact that it comprises the exosome as defined in claim 24, and an excipient.
[26]
26. Pharmaceutical composition according to claim 25, characterized in that the pharmaceutical composition comprises a lower concentration of macromolecules than the sample, wherein the macromolecules are nucleic acids, contaminating proteins, lipids, carbohydrates, metabolites or a combination thereof.
[27]
27. Pharmaceutical composition according to claim 26, characterized in that the pharmaceutical composition is substantially free of macromolecules.
[28]
28. Exosome characterized by the fact that it comprises a target protein, in which at least part of the target protein is expressed from an exogenous sequence, and the target protein comprises PTGFRN, BSG, IGSF3, IGSF8, IGSF2, ITGB1, ITGA4, SLC3A2, ATP carrier or a fragment or variant thereof.
[29]
29. Exosome according to claim 28, characterized in that the target protein is present on the surface of the exosome at a higher density than a different target protein than a different exosome, wherein the different target protein comprises a protein conventional exosomal or a variant thereof.
[30]
30. Exosome, according to claim 29, characterized by the fact that the conventional exosomal protein is selected from the group consisting of CD9, CD63, CD81, PDGFR, GPI anchoring proteins, lactaderine, LAMP2, LAMP2B and a fragment thereof .
[31]
31. Exosome according to any one of claims 28 to 30, characterized in that the target protein comprises a polypeptide of SEQ ID NO: 33.
[32]
32. Exosome according to any one of claims 28 to 31, characterized in that it is isolated on the basis of a bond between the target protein and a binding agent.
[33]
33. Exosome according to any one of claims 28 to 32, characterized in that it is produced from a cell genetically modified to comprise the exogenous sequence, optionally in which the cell is a HEK293 cell.
[34]
34. Exosome according to claim 33, characterized by the fact that the cell is genetically modified to have reduced expression of ADAM10.
[35]
35. Exosome according to any one of claims 33 to 34, characterized in that the cell comprises a plasmid comprising the exogenous sequence.
[36]
36. Exosome according to any one of claims 33 to 35, characterized by the fact that the cell comprises the exogenous sequence inserted into a genome of the cell.
[37]
37. Exosome according to claim 36, characterized by the fact that the exogenous sequence is inserted into a genomic site located at the 3 'or 5' end of a genomic sequence encoding PTGFRN, BSG, IGSF3, IGSF2, ITGB1, ITGA4 , SLC3A2 or ATP transporter.
[38]
38. Exosome according to claim 36, characterized by the fact that the exogenous sequence is inserted into a genomic sequence encoding PTGFRN, BSG, IGSF3, IGSF2, ITGB1, ITGA4, SLC3A2 or ATP transporter.
[39]
39. Exosome according to any one of claims 28 to 38, characterized in that the target protein is a fusion protein comprising PTGFRN, BSG, IGSF3, IGSF2, ITGB1, ITGA4, SLC3A2, ATP transporter or a fragment or a variant thereof, and an affinity marker, wherein the affinity marker has affinity for the binding agent.
[40]
40. Exosome according to any one of claims 28 to 38, characterized in that the target protein is a fusion protein comprising PTGFRN, BSG, IGSF3, IGSF2, ITGB1, ITGA4, SLC3A2, ATP transporter or a fragment or a variant thereof and a therapeutic peptide.
[41]
41. Exosome according to claim 40, characterized in that the therapeutic peptide is selected from the group consisting of a natural peptide, a recombinant peptide, a synthetic peptide or a peptide linker to a therapeutic compound.
[42]
42. Exosome according to claim 40, characterized by the fact that the therapeutic compound is selected from the group consisting of nucleotides, amino acids, lipids, carbohydrates and small molecules.
[43]
43. Exosome according to claim 40, characterized by the fact that the therapeutic peptide is an antibody or a fragment or a variant thereof.
[44]
44. Exosome according to claim 40, characterized by the fact that the therapeutic peptide is an enzyme, a linker, a receptor or a fragment or a variant thereof.
[45]
45. Exosome according to claim 40, characterized by the fact that the therapeutic peptide is an antimicrobial peptide or a fragment or variant thereof.
[46]
46. Exosome according to any one of claims 28 to 38, characterized in that the target protein is a fusion protein comprising PTGFRN, BSG, IGSF3, IGSF2, ITGB1, ITGA4, SLC3A2, ATP transporter or a fragment or a variant of them and a fraction of targeting.
[47]
47. Exosome, according to claim 46, characterized by the fact that the targeting fraction is specific to an organ, tissue or cell.
[48]
48. Exosome according to any one of claims 28 to 47, characterized in that it further comprises a different target protein, wherein the different target protein comprises PTGFRN, BSG, IGSF3, IGSF2, ITGB1, ITGA4, SLC3A2, transporter ATP or a fragment or variant thereof.
[49]
49. Exosome according to claim 48, characterized by the fact that it is isolated based on a link between the different target protein and a different binding agent.
[50]
50. Pharmaceutical composition characterized by the fact that it comprises the exosome as defined in any one of claims 28 to 49, and an excipient.
[51]
51. Pharmaceutical composition according to claim 50, substantially free of macromolecules, characterized by the fact that macromolecules are selected from nucleic acids, contaminating proteins, lipids, carbohydrates, metabolites and a combination thereof.
[52]
52. Cell line characterized by the fact that it is for the production of the exosome as defined in any of claims 28 to 49.
[53]
53. Cell line for the production of exosomes, characterized by the fact that it comprises an exogenous sequence inserted in a genomic sequence encoding PTGFRN, BSG, IGSF3, IGSF2, ITGB1, ITGA4, SLC3A2 or ATP transporter, in which the exogenous sequence is the genomic sequence encodes a fusion protein.
[54]
54. Cell line according to claim 53, characterized by the fact that the exogenous sequence encodes an affinity marker.
[55]
55. Cell line according to claim 53, characterized by the fact that the exogenous sequence encodes a therapeutic peptide.
[56]
56. Cell line according to claim 55, characterized in that the therapeutic peptide is selected from the group consisting of a natural peptide, a recombinant peptide, a synthetic peptide or a peptide linker to a therapeutic compound.
[57]
57. Cell line according to claim 55, characterized by the fact that the therapeutic compound is selected from the group consisting of nucleotides, amino acids, lipids, carbohydrates and small molecules.
[58]
58. Cell line according to claim 55, characterized by the fact that the therapeutic peptide is an antibody or a fragment or a variant thereof.
[59]
59. Cell line according to claim 55, characterized by the fact that the therapeutic peptide is an enzyme, a linker, a receptor or a fragment or a variant thereof.
[60]
60. Cell line according to claim 55, characterized by the fact that the therapeutic peptide is an antimicrobial peptide or a fragment or variant thereof.
[61]
61. Cell line according to claim 53, characterized by the fact that the exogenous sequence encodes a targeting fraction.
[62]
62. Cell line according to claim 61, characterized by the fact that the targeting fraction is specific to an organ, tissue or cell.
[63]
63. Cell line according to any one of claims 53 to 62, characterized by the fact that the cell line is genetically modified to have reduced expression of ADAM10.
[64]
64. Exosome, characterized by the fact that it is produced from the cell line as defined in any one of claims 53 to 63.
[65]
65. Exosome according to claim 64, characterized in that the exosome includes the surface fusion protein at a higher density than a different fusion protein on the surface of a different exosome, where the different exosome is produced from a different cell line comprising the exogenous sequence inserted into a different genomic sequence encoding a conventional exosomal protein, where the exogenous sequence and the different genomic sequence encode the different fusion protein.
[66]
66. Exosome according to claim 65, characterized by the fact that the conventional exosomal protein is selected from the group consisting of CD9, CD63, CD81, PDGFR, GPI anchoring proteins, lactaderine, LAMP2, LAMP2B and a fragment thereof .
[67]
67. Method for isolating a non-exosomal material, characterized by the fact that it comprises the steps of: providing a sample comprising an exosome and the non-exosomal material; placing the sample in contact with a binding agent with affinity for a target protein, wherein the target protein comprises PTGFRN, BSG, IGSF2, IGSF3, IGSF8, ITGB1, ITGA4, SLC3A2, ATP transporter or a fragment or variant thereof , thus inducing the exosome to bind to the binding agent; and isolating the non-exosomal material.
[68]
68. Method according to claim 67, characterized by the fact that the non-exosomal material is a virus or a protein.
[69]
69. Method according to claim 68, characterized by the fact that the non-exosomal material is lentivirus, retrovirus, adeno-associated virus or other enveloped or non-enveloped virus.
[70]
70. The method of claim 68, characterized by the fact that the non-exosomal material is a recombinant protein.
[71]
71. Method according to any of claims 67 to 70, characterized in that the isolated non-exosomal material is substantially free of exosomes.
[72]
72. The method of any one of claims 67 to 71, characterized in that the target protein further comprises an affinity marker, wherein the affinity marker has affinity for the binding agent.
[73]
73. Method according to any one of claims 67 to 72, characterized in that the target protein comprises a polypeptide of SEQ ID NO: 33.
[74]
74. Method according to any one of claims 67 to 73, characterized in that the binding agent comprises an immunoglobulin, a protein, a peptide or a small molecule.
[75]
75. Method according to any of the claims
67 to 74, characterized by the fact that the binding agent is attached to a solid support, optionally wherein the solid support comprises a porous agarose sphere, a microtiter plate, a magnetic sphere or a membrane.
[76]
76. The method of claim 75, characterized in that the solid support forms a chromatography column.
[77]
77. Method, according to claim 76, characterized by the fact that the step of contacting the sample with the binding agent is carried out by applying the sample to the chromatography column.

类似技术:

---

公开号 | 公开日 | 专利标题

---

BR112020003354A2|2020-08-18|preparation of therapeutic exosomes using membrane proteins

---

KR20200091390A|2020-07-30|Composition of engineered exosome and method of loading lumen exosome payload

---

JP6983455B2|2021-12-17|High-purity RNA composition and methods for its preparation

---

US20200390700A1|2020-12-17|Targeted extracellular vesicles comprising membrane proteins with engineered glycosylation sites

---

Li et al.2016|Lysosomal membrane glycoproteins bind cholesterol and contribute to lysosomal cholesterol export

---

JP6037593B2|2016-12-07|Identification of tumor-associated antigens for diagnosis and treatment

---

WO2014160284A1|2014-10-02|Compositions and methods for treatment of stroke

---

GB2437727A|2007-11-07|Aptamers against MUC1 and their uses

---

US20170204445A1|2017-07-20|In vivo site-specific protein tagging using engineered sortase variants

---

US10640772B2|2020-05-05|DNA aptamers binding to molecular targeted agents and detection method of molecular targeted medicine using the same

---

EA023541B1|2016-06-30|Insulin-like growth factor 1 receptor binding peptides

---

CN113186203A|2021-07-30|Vaccine agent for treating or preventing coronavirus diseases

---

AU2020217716A1|2021-08-26|Membrane protein scaffolds for exosome engineering

---

KR20180050261A|2018-05-14|Novel fusion proteins comprising single chain fragment variable and viral coat protein, and uses thereof

---

Nikitina et al.2014|A new immuno-PCR format for serological diagnosis of colon cancer

---

BR102017001563A2|2020-02-18|RNA APTAMERS AND THEIR DIAGNOSTIC AND THERAPEUTIC APPLICATIONS IN PROSTATE CANCER

---

WO2021012082A1|2021-01-28|β-AMYLOID CIRCULAR RIBONUCLEIC ACID, POLYPEPTIDE AND USE THEREOF

---

JPWO2018194015A1|2020-03-12|How to obtain antigen-specific antibody information

---

JP2022519275A|2022-03-22|Membrane protein scaffolding for exosome manipulation

---

EP3920958A1|2021-12-15|Treatment of cancer metastasis by targeting exosome proteins

---

CN110317814A|2019-10-11|Beta-amyloid protein ring-type ribonucleic acid, polypeptide and its application

---

CN114058623A|2022-02-18|Aptamer recognition and integrin alpha 3 subunit combination and related functions thereof

---

JP2020501521A5|2020-12-17|

---

Stephens2011|Identification of Putative Interacting Proteins with CTHY28

同族专利:

---

公开号 | 公开日

---

EP3672573A4|2021-05-26|

---

PH12020500308A1|2021-02-08|

---

US20190060483A1|2019-02-28|

---

US20200222556A1|2020-07-16|

---

WO2019040920A8|2019-04-04|

---

EP3672573A1|2020-07-01|

---

CA3072352A1|2019-02-28|

---

SG11202001008RA|2020-03-30|

---

CN111212632A|2020-05-29|

---

CO2020001872A2|2020-06-19|

---

US10195290B1|2019-02-05|

---

AU2018321927A1|2020-02-27|

---

WO2019040920A1|2019-02-28|

---

IL272786D0|2020-04-30|

---

KR20200071065A|2020-06-18|

---

JP2020531018A|2020-11-05|

---

US10561740B2|2020-02-18|

---

CL2020000428A1|2020-11-27|

---

US20190117792A1|2019-04-25|

引用文献:

---

公开号 | 申请日 | 公开日 | 申请人 | 专利标题

---

---

US5747660A|1995-11-06|1998-05-05|The University Of Colorado|Nucleic acid encoding prostaglandin F2α receptor regulatory protein|

---

CN1254234C|2000-06-09|2006-05-03|莱古伦公司|Plasmid DNA and nucleas-containing location signal/fusogene conjogates drug encapsulating into targeted liposomes complex|

---

US20040049010A1|2001-10-26|2004-03-11|Warren Bridget A|Transmembrane proteins|

---

US7803906B2|2002-03-22|2010-09-28|Gene Signal International Sa|Composition comprising an angiogenesis related protein|

---

EP1945754B1|2005-10-31|2014-07-23|The Regents Of The University Of Michigan|Compositions and methods for treating and diagnosing cancer|

---

US9085778B2|2006-05-03|2015-07-21|VL27, Inc.|Exosome transfer of nucleic acids to cells|

---

AU2011316477A1|2010-10-11|2013-05-02|Medsaic Pty Ltd|Assay for disease detection|

---

US9777042B2|2011-12-15|2017-10-03|Morehouse School Of Medicine|Method of purifying HIV/SIV Nef from exosomal fusion proteins|

---

US20150301058A1|2012-11-26|2015-10-22|Caris Science, Inc.|Biomarker compositions and methods|

---

CA2894668A1|2012-12-12|2014-06-19|The Broad Institute, Inc.|Crispr-cas component systems, methods and compositions for sequence manipulation|

---

JP6571537B2|2013-03-13|2019-09-04|ザ ユニバーシティー オブ クイーンズランド|Methods for isolating cells for therapy and prevention|

---

KR20150043937A|2013-10-15|2015-04-23|삼성전자주식회사|A compositon for diagnosing a liver cancer in a subject, method for diagnosing a liver cancer in a subject and method for obtaining information for diagnosing a liver cancer in a subject|

---

JP2017536096A|2014-10-09|2017-12-07|アントフロゲネシス コーポレーション|Placenta-derived adherent cell exosomes and their use|

---

WO2016077639A2|2014-11-12|2016-05-19|VL27, Inc.|Nanovesicular therapies|

---

WO2017075708A1|2015-11-05|2017-05-11|Exerkine Corporation|Exosomes useful to treat cystic fibrosis|

---

AU2016381513A1|2015-12-30|2018-07-19|The Regents Of The University Of California|Methods for enhanced production and isolation of cell-derived vesicles|

---

JP2019513019A|2016-03-15|2019-05-23|コディアック バイオサイエンシズ インコーポレイテッド|Therapeutic membrane vesicles|

---

WO2018226758A2|2017-06-05|2018-12-13|The Regents Of The University Of California|Methods for enhanced production and isolation of cell-derived vesicles and treatment of inflammation and neurological damage|

---

JP2020531018A|2017-08-25|2020-11-05|コディアック バイオサイエンシズ インコーポレイテッド|Preparation of therapeutic exosomes using membrane proteins|EP3841112A1|2018-08-24|2021-06-30|Codiak BioSciences, Inc.|Extracellular vesicles targeting dendritic cells and uses thereof|

---

JP2020531018A|2017-08-25|2020-11-05|コディアック バイオサイエンシズ インコーポレイテッド|Preparation of therapeutic exosomes using membrane proteins|

---

SG11202104956QA|2018-11-16|2021-06-29|Codiak Biosciences Inc|Engineered extracellular vesicles and uses thereof|

---

BR112020013131A2|2017-12-28|2020-12-08|Codiak Biosciences, Inc.|EXOSOMES FOR IMMUNO-ONCOLOGY AND ANTI-INFLAMMATORY THERAPY|

---

US20200407725A1|2018-02-12|2020-12-31|Codiak Biosciences, Inc.|Methods and compositions for macrophage polarization|

---

BR112020019089A2|2018-03-23|2020-12-29|Codiak Biosciences, Inc.|EXTRACELLULAR VESICLES UNDERSTANDING STING AGONIST|

---

WO2019246591A1|2018-06-21|2019-12-26|Codiak Biosciences, Inc.|Methods of measuring extracellular vesicles and nanoparticles in complex matrices by light scattering|

---

WO2020163366A1|2019-02-04|2020-08-13|Codiak Biosciences, Inc.|Treatment of cancer metastasis by targeting exosome proteins|

---

WO2020163370A1|2019-02-04|2020-08-13|Codiak Biosciences, Inc.|Membrane protein scaffolds for exosome engineering|

---

WO2020191369A1|2019-03-21|2020-09-24|Codiak Biosciences, Inc.|Process for preparing extracellular vesicles|

---

WO2020191392A1|2019-03-21|2020-09-24|Applied Stemcell, Inc.|Exosomes containing rna with specific mutation|

---

SG11202109702QA|2019-03-21|2021-10-28|Codiak Biosciences Inc|Extracellular vesicles for vaccine delivery|

---

WO2021189047A2|2020-03-20|2021-09-23|Codiak Biosciences, Inc.|Extracellular vesicles for therapy|

---

EP3941528A1|2019-03-21|2022-01-26|Codiak BioSciences, Inc.|Extracellular vesicle conjugates and uses thereof|

---

EP3956456A1|2019-04-17|2022-02-23|Codiak BioSciences, Inc.|Compositions of exosomes and aav|

---

WO2020214961A1|2019-04-17|2020-10-22|Codiak Biosciences, Inc.|Methods of treating tuberculosis|

---

JPWO2020235566A1|2019-05-21|2020-11-26|

---

WO2021003445A1|2019-07-03|2021-01-07|Codiak Biosciences, Inc.|Extracellular vesicles targeting t cells and uses thereof|

---

WO2021003425A1|2019-07-03|2021-01-07|Codiak Biosciences, Inc.|Methods of inducing hematopoiesis|

---

WO2021030780A1|2019-08-14|2021-02-18|Codiak Biosciences, Inc.|Extracellular vesicle-aso constructs targeting cebp/beta|

---

WO2021030781A1|2019-08-14|2021-02-18|Codiak Biosciences, Inc.|Extracellular vesicles with antisense oligonucleotides targeting kras|

---

WO2021030773A1|2019-08-14|2021-02-18|Codiak Biosciences, Inc.|Extracellular vesicle-nlrp3 antagonist|

---

WO2021030768A1|2019-08-14|2021-02-18|Codiak Biosciences, Inc.|Extracellular vesicles with stat3-antisense oligonucleotides|

---

WO2021030776A1|2019-08-14|2021-02-18|Codiak Biosciences, Inc.|Extracellular vesicle-aso constructs targeting stat6|

---

AU2020327360A1|2019-08-14|2022-02-17|Codiak Biosciences, Inc.|Extracellular vesicle linked to molecules and uses thereof|

---

WO2021062290A1|2019-09-25|2021-04-01|Codiak Biosciences, Inc.|Methods of producing extracellular vesicles|

---

WO2021062058A1|2019-09-25|2021-04-01|Codiak Biosciences, Inc.|Sting agonist comprising exosomes for treating neuroimmunological disorders|

---

WO2021062317A1|2019-09-25|2021-04-01|Codiak Biosciences, Inc.|Extracellular vesicle compositions|

---

WO2021062060A1|2019-09-25|2021-04-01|Codiak Biosciences, Inc.|Sting agonist comprising exosomes combined with il-12 displaying exosomes for treating a tumour|

---

WO2021062057A1|2019-09-25|2021-04-01|Codiak Biosciences, Inc.|Exogenous loading of exosomes via lyophilization|

---

WO2021092193A1|2019-11-05|2021-05-14|Codiak Biosciences, Inc.|High-throughput chromatography screening for extracellular vesicles|

---

WO2021146616A1|2020-01-17|2021-07-22|Codiak Biosciences, Inc.|Cholesterol assays for quantifying extracellular vesicles|

---

WO2021154888A1|2020-01-27|2021-08-05|Mantra Bio. Inc.|Non-naturally occurring vesicles comprising a chimeric vesicle localization moiety, methods of making and uses thereof|

---

WO2021184021A1|2020-03-13|2021-09-16|Codiak Biosciences, Inc.|Extracellular vesicle-aso constructs targeting pmp22|

---

WO2021184022A1|2020-03-13|2021-09-16|Codiak Biosciences, Inc.|Targeted delivery of extracellular vesicles|

---

WO2021184017A1|2020-03-13|2021-09-16|Codiak Biosciences, Inc.|Extracellular vesicles for treating neurological disorders|

---

WO2021184020A1|2020-03-13|2021-09-16|Codiak Biosciences, Inc.|Methods of treating neuroinflammation|

---

WO2021195154A1|2020-03-23|2021-09-30|Avem Holdings, Llc|Isolation and purification of exosomes for regenerative medicine|

---

WO2021237100A1|2020-05-21|2021-11-25|Codiak Biosciences, Inc.|Methods of targeting extracellular vesicles to lung|

---

WO2021248133A1|2020-06-05|2021-12-09|Codiak Biosciences, Inc.|Anti-transferrin extracellular vesicles|

---

WO2022040223A1|2020-08-17|2022-02-24|Codiak Biosciences, Inc.|Methods of treating cancer|

---

CN113252616A|2021-01-29|2021-08-13|厦门大学|Glycosylation research method of exosome|

法律状态:
2021-11-03| B350| Update of information on the portal [chapter 15.35 patent gazette]|

优先权:

---

申请号 | 申请日 | 专利标题

---

US201762550543P| true| 2017-08-25|2017-08-25|

---

US62/550,543|2017-08-25|

---

US201862656956P| true| 2018-04-12|2018-04-12|

---

US62/656,956|2018-04-12|

---

PCT/US2018/048026|WO2019040920A1|2017-08-25|2018-08-24|Preparation of therapeutic exosomes using membrane proteins|

---